For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:69190490+69190866 377bp GAGAGGGAAACCAGGAAAGG CTGCGGATTGCCTGAGTGT
Mutant = ~ 315 bp
Heterozygote = ~ 315 bp and 377 bp
Wild type = 377 bp
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52850 | GAG AGG GAA ACC AGG AAA GG | Common | A, B | |||
| 52851 | CTG CGG ATT GCC TGA GTG T | Wild type Reverse | A | |||
| oIMR9074 | AGG CAA ATT TTG GTG TAC GG | Mutant Reverse | B |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 52850 | 0.50 uM |
| 52851 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Reaction B
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 52850 | 0.50 uM |
| oIMR9074 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 033760 | STOCK Braftm1Mmcm Gt(ROSA)26Sortm3(CAG-EYFP)Hze Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033754 | STOCK Brca2tm1Brn Gt(ROSA)26Sortm3(CAG-EYFP)Hze Trp53tm1Brn Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033752 | STOCK Gt(ROSA)26Sortm1(TMPRSS2/ERG)Key Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033763 | STOCK Gt(ROSA)26Sortm2(myc*T58A)Rcse Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033753 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Brca1tm2Cxd Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033761 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Krastm4Tyj Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033757 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu Tg(ARR2/Pbsn-MYC)7Key/AbshnJ |
| 033751 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033759 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Nkx3-1tm4(cre/ERT2)Mms Smad4tm2.1Cxd Ptentm1Hwu/AbshnJ |
| 033750 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Nkx3-1tm4(cre/ERT2)Mms/AbshnJ |
| 033755 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Trp53tm1Brn Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033756 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Trp53tm1Brn/Trp53tm3Tyj Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 032753 | STOCK Nkx3-1tm4(cre/ERT2)Mms/AbshnJ |
| 13 strains use this protocol | |