CAST/EiJ-Mecp2^em1Grib/J

Stock number: 037503
Product name: Mecp2^NLucTom
Research areas: Mouse/Human Gene Homologs, Neurobiology Research, Research Tools

Description

Mecp2^NLucTom knock-in mice contain a CRISPR/cas9 generated insertion of a NanoLuciferase-P2A-TdTomato (NLucTom) immediately before the stop codon of the Mecp2 gene. These mice may be useful for studying impaired neurodevelopmental maturation associated with human Rett syndrome. They are also useful for studying X chromosome inactivation and reactivation.

Detailed description

Mecp2^NLucTom knock-in mice contain a CRISPR/cas9 generated insertion of a NanoLuciferase-P2A-TdTomato (NLucTom) construct immediately before the stop codon of the methyl CpG binding protein 2 (Mecp2) gene. Specifically, the construct contains (from 5’ to 3’) NLuc, a P2A ribosomal skip cleavage peptide sequence, and a constitutively fluorescent monoclonal orange fluorescent protein (tdTomato) reporter sequence. NLuc is a luciferase enzyme smaller and 100 times brighter than the regular firefly luciferase. In these mice, Mecp2-NLuc is expressed as a fusion protein, while tdTomato is generated as an independent protein due to the presence of the P2A peptide sequence. MECP2 is a nuclear protein that contains a methyl-CpG binding domain (MBD) which binds specifically to methylated DNA. MECP2 can also repress transcription from methylated gene promoters. MECP2 is X-linked and subject to X inactivation, and has been found to be dispensable in stem cells and embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome (RTT), a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. RTT is characterized by a period of apparently normal development followed by loss of cognitive and psychomotor skills.

This strain has a dual capability that permits not only measurement of NLuc activity at a populational level, but also measurement of tdTomato fluorescence at the single-cell level. When bred with a mouse line with the inactive X specific transcripts (Xist) gene knocked-out, for example Xist^2lox (Stock No. 037548) crossed to Zp3-cre mice (see Stock No. 003651), the neural cells from these mice are useful for studying X chromosome reactivation.

While the donating investigator reports that homozygous females are viable and fertile, they breed less efficiently than heterozygous females with hemizygous males.

Development

A guide RNA (TTAGCTGACTTTACATAGAG) was designed to fuse the NanoLuciferase-P2A-TdTomato (NLucTom) construct with the C-terminus, immediately before the stop codon, of the methyl CpG binding protein 2 (Mecp2) gene. Because of this guide RNA, 18bp of the 3'UTR directly downstream of the STOP codon have been deleted. Specifically, the construct contained (from 5’ to 3’) NLuc, a P2A ribosomal skip cleavage peptide sequence, and a constitutively fluorescent monoclonal orange fluorescent protein (tdTomato) reporter sequence. The guide RNA, donor plasmid, and the cas9 nuclease were electroporated into Cast/EiJ-derived embryonic stem (ES) cells. Correctly targeted ES cells were injected into C57BL/6 blastocysts. Correctly targeted pups were identified by sequencing and PCR and resulting Mecp2^NLucTom mice were kept on a Cast/EiJ genetic background (Stock No. 000928) by many backcrosses to remove off-target CRISPR changes. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize Cast/EiJ oocytes.

Allele

Symbol: Mecp2^em1Grib
Name: endonuclease-mediated mutation 1, Joost Gribnau
MGI accession ID: MGI:7314169
Generation method: Endonuclease-mediated
Attributes: Reporter
Marker symbol: Mecp2
Marker name: methyl CpG binding protein 2
Chromosome: X
Strain of origin: Not Applicable
Molecular note: A guide RNA (TTAGCTGACTTTACATAGAG) is designed to fuse the NanoLuciferase-P2A-TdTomato (NLucTom) construct with the C-terminus, immediately before the stop codon, of the gene. Because of this guide RNA, 18bp of the 3'UTR directly downstream of the STOP codon has been deleted. Specifically, the construct contained (from 5' to 3') NLuc, a P2A ribosomal skip cleavage peptide sequence, and a constitutively fluorescent monoclonal orange fluorescent protein (tdTomato) reporter sequence.