B6(SJL)-Bin1^em1Aduci/J

Stock number: 035872
Product name: Bin1^K358R
Strain synonyms: Bin1^K426R
Research areas: Mouse/Human Gene Homologs, Neurobiology Research

Description

Bin1^K358R is a CRISPR/Cas9-generated mutant of the bridging integrator 1 (Bin1) gene carrying the K426R mutation that corresponds to the human K358R SNP associated with increased risk of sporadic Alzheimer's disease. These mice may be useful in pre-clinical studies of AD.

Detailed description

BIN1 is an important regulator of endocytosis and membrane dynamics, in addition to others. Neuronal BIN1 localizes to pre-synaptic termini where it functions in excitatory synaptic transmission via regulation of neurotransmitter vesicle dynamics. In humans, the 19 exon gene produces multiple isoforms with 7 brain specific isoforms.

To create the Bin1^K358R allele, CRISPR/Cas9 endonuclease-mediated genome editing of Bin1 was used to introduce a K426R mutation. This mutant allele models a SNP (rs138047593) found in human BIN1 that encodes a missense mutation associated with increased risk of sporadic Alzheimer's disease. The K358R variant in human BIN1 (K542R in the BIN1-202 isoform) is located within the C-terminal SH3 domain.

RNA-seq analysis of hippocampus and cortex indicates that the Bin1^K358R allele is expressed at a level similar to the wild-type Bin1 allele, with no evidence of cryptic splicing products from the mutant allele.

Both heterozygous and homozygous mice are viable and fertile.



When crossed to 5xFAD mice (Mmjax No. 34848), hemizygous 5xFAD/homozygous Bin1^K358R (5xFAD/BIN1^K358R) mice have altered glial responses to plaques, most notably in astrocytes and oligodendrocytes whose normal responses are impaired/suppressed. This is associated with reduced plasma neurofilament light chain (NfL) in response to plaques, a marker of neuronal damage.

Development

Guide RNA (GATGAGCTGCAACTCAAAGC) was designed to create an AAA to AGG missense mutation resulting in a lysine to arginine change (K426R) in the bridging integrator 1 (Bin1) gene. This mutation (SNP rs138047593) is homologous to the human K358R SNP which has been shown to correlate with increased risk of sporadic Alzheimer's disease. One silent DNA mutation was also introduced. The crRNA, tracrRNA and CAS9 nuclease were complexed to form an RNP, then introduced into the cytoplasm of C57BL/6J-derived zygotes with well recognized pronuclei. Surviving embryos were transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice (Stock No. 000664) for germline transmission. The Bin1^K358R colony was backcrossed to C57BL/6J for a total of at least two generations. At some point during development these mice were also bred to 5xFAD Tg mice (Stock No. 008730). The 5xFAD Tg was bred out of the mice that were shipped to The Jackson Laboratory. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Bin1^em1Aduci
Name: endonuclease-mediated mutation 1, Frank LaFerla
MGI accession ID: MGI:6501985
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Synonyms: BIN1^K358R
Marker symbol: Bin1
Marker name: bridging integrator 1
Marker synonyms: AMPH2; Amphiphysin 2; Amphl; CNM2; SH3P9
Chromosome: 18
Strain of origin: C57BL/6J
Molecular note: Guide RNA (GATGAGCTGCAACTCAAAGC) is designed to create an AAA to AGG missense mutation resulting in a lysine to arginine change at amino acid 537 (K537R). The K537R mutation is homologous to the human K542R SNP which has been shown to correlate with increased risk of sporadic Alzheimer's disease. One silent DNA mutation was also introduced.