B6(129S4)-Cpt1a^em1Fink/J

Stock number: 035711
Product name: Cpt1a^fl
Research areas: Developmental Biology Research, Metabolism Research, Research Tools

Description

Cpt1a^fl/fl mice have exon 4 of the carnitine palmitoyltransferase 1a, liver gene floxed, making these mice useful for studying long chain fatty acid oxidation.

Detailed description

Cpt1a^fl/fl mice have loxP sites flanking exon 4 of the carnitine palmitoyltransferase 1a, liver (Cpt1a) gene. CPT1A is present in the outer mitochondrial membrane where it is considered the rate-controlling enzyme for long-chain fatty acid β-oxidation (FAO). Mice that are homozygous for this allele are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exon 4 deleted in the cre-expressing tissues.

When bred to Lyz2-Cre mice (Stock No. 004781), macrophages from the resulting CPT1a M-KOT mice, with myeloid specific deletion of CPT1A, exhibit impaired FAO, enhanced expression of the CD36 scavenger receptor, increased uptake of oxidized low-density lipoprotein (oxLDL), and augmented transformation into cholesterol-rich foam cells.

Development

The L1L2_Bact_P cassette was inserted at a position on chromosome 19 upstream of exon 4 of the carnitine palmitoyltransferase 1a, liver (Cpt1a) gene. The cassette is composed of an FRT site followed by a lacZ sequence and a loxP site. This first loxP site was followed by neomycin under the control of the human beta-actin promoter, SV40 polyA, a second FRT site and a second loxP site. A third loxP site was inserted downstream of exon 4. The construct, clone HEPD0727_3_A09, was introduced into C57BL/6N-A^tm1Brd-derived JM8A3.N1 embryonic stem (ES) cells, and correctly targeted ES cells were injected into blastocysts. The resulting chimeric males were bred to C57BL/6 females. Mice were bred to FLPo mice (Stock No. 012930) to remove the lacZ and neo cassettes.

It was noted by Dr. Toren Finkel (NIH, National Heart, Lung, and Blood Institute), who obtained the original ES cell clone, that the 3’ loxP site was absent. To remedy this, Dr. Finkel designed sgRNA (CCAGATGAGCCGTCTGCCCAGGG) designed to cut Intron 4, and a single strand oligonucleotides (CAGTGACCAAACCCAGAGCTTCATGCCTGGCTTACCCAGATGAGCCGTCTGATAACTTCGTATAGCATACATTATACGAAGTTATGGATCCCCCAGGGAAGGACATCCAAAGCCCCAACGAGCTGCTTTTATAAGCTTAGC) containing a loxP site flanked by short homologous arms to insert a loxP site into intron 4. The sgRNA, Casp9 mRNA, and donor oligos were co-microinjected into zygotes generated by in vitro fertilization using sperm obtained from a male mouse containing the 5’ Cpt1a loxP site and eggs collected from wildtype C57BL/6J mice. Correctly targeted embryos were transferred to pseudopregnant females. Cpt1a^fl/fl offspring were identified by PCR and sequencing and were further bred to C57BL/6J mice for 6 generations by the donating laboratory (see SNP note below). Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes (Stock No. 000664).

In 2021, A 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. One of the 43 markers throughout the genome were segregating with 129. Also, two of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating, including the rd8 recessive mutation associated with retinal degeneration on Chromosome 1 within the Crb1 locus. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed C57BL/6N;C57BL/6J genetic background.

Allele

Symbol: Cpt1a^em1Fink
Name: endonuclease-mediated mutation 1, Toren Finkel
MGI accession ID: MGI:6470470
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed)
Synonyms: Cpt1a^fl
Marker symbol: Cpt1a
Marker name: carnitine palmitoyltransferase 1a, liver
Marker synonyms: CPT1; CPT1-L; CPTI; CPT-Ia; L-CPT I; L-CPT1
Chromosome: 19
Strain of origin: (C57BL/6N-A^tm1Brd x C57BL/6J)F1
Molecular note: Theoriginal targeting construct is composed of an FRT site followed by a lacZ sequence and a loxP site inserted upstream of exon 4. This first loxP site was followed by neomycin under the control of the human beta-actin promoter, SV40 polyA, a second FRT site and a second loxP site. A third loxP site was inserted downstream of exon 4. The construct, clone HEPD0727_3_A09, was introduced into C57BL/6N-A^tm1Brd-derived JM8A3.N1 embryonic stem (ES) cells. Flp-mediated recombination removed the FRT-flanked lacZ and neo cassette. It was then determined that the third loxP site was absent and the ES cell line was retargeted using CRISPR/Cas9 genome editing to insert a loxP site downstream of exon 4.