C57BL/6J-Rag1^em10Lutzy/J

Stock number: 034159
Product name: B6J.Rag1 KO
Strain synonyms: B6 Rag1 KO
Research areas: Cancer Research, Hematological Research, Immunology, Inflammation and Autoimmunity Research, Internal/Organ Research, Research Tools, Virology Research

Description

B6J.Rag1 KO is a CRISPR/Cas9 generated knock-out allele of the recombination activating gene 1 locus carrying a 3,527-nt deletion developed at The Jackson Laboratory Rare Disease Translational Center. These mice may be useful in studying B and T cell deficiency as well as for xenograft/transplantation.

This coisogenic mutant strain is an alternative to the congenic strain, Stock No. 002216 B6.129S7-Rag1^tm1Mom/J.

Detailed description

To create the B6J.Rag1 KO allele, CRISPR/Cas9 endonuclease-mediated genome editing of the recombination activating 1 gene (Rag1) exon 2 region resulted in a 3,527-nt deletion (AGTATAAGTGTCCCCAAAT//3527 deletion//GGTCAGGGATCGATAGTTGACAAG). This is designed to create a knock-out allele where homozygotes would have greatly/completely impaired production of mature T cells or B cells.
In June 2021, analyses performed by The Jackson Laboratory on B6J.Rag1 KO homozygous mice (N=12) show the circulating T lymphocytes population is completely ablated and only ~1-2% residual CD19+ B cell population is detected in circulation. These results were not significantly different than those observed for Stock No. 002216 in the same study.

Both heterozygous and homozygous mice are viable and fertile.

The Rag1 gene encodes a protein that is part of the multiprotein RAG complex which is involved in V(D)J recombination. Mutations in this gene have been associated with Omenn syndrome, alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity, combined cellular and humoral immune defects with granulomas and severe combined immunodeficiency, B cell-negative.

Development

The B6J.Rag1 KO allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing at The Jackson Laboratory Rare and Orphan Disease Center. Guide RNAs [AAGTGTCCCCAAATATTGTC ; GCACCTAGCACATTGCCATG] were selected to target intronic DNA flanking exon 2 of the recombination activating gene 1 (Rag1) on Chromosome 2. No oligonucleotide donor sequences were used. These guides and cas9 nuclease were introduced into single cell C57BL/6J zygotes and transferred to pseudopregnant females. DNA sequencing of the targeted region identified one male (founder 5410) harboring a 3,527-nt deletion (AGTATAAGTGTCCCCAAAT//3527 deletion//GGTCAGGGATCGATAGTTGACAAG) that resulted in loss of exon 2 from the genome. This founder male was bred to C57BL/6J mice (Stock No. 000664) for germline transmission. They were then bred to C57BL/6J for at least two generations before intercrossing to establish the homozygous mutant B6.Rag1 KO colony.

Allele

Symbol: Rag1^em10Lutzy
Name: endonuclease-mediated mutation 10, Cathy Lutz
MGI accession ID: MGI:6681855
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Rag1
Marker name: recombination activating gene 1
Marker synonyms: RAG-1; RNF74
Chromosome: 2
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing is used to target intronic DNA flanking exon 2 (guide RNAs - AAGTGTCCCCAAATATTGTC ; GCACCTAGCACATTGCCATG). DNA sequencing of the targeted region identified a 3,527-nt deletion (AGTATAAGTGTCCCCAAAT//3527 deletion//GGTCAGGGATCGATAGTTGACAAG) that results in loss of exon 2 from the genome.