An engineered T-to-C point mutation upstream of the Scimp locus models the Alzheimer's disease non-coding risk variant rs61481506, a conserved eQTL that modifies expression of three nearby candidate genes (SCIMP, NUP88 and ZNF323).
This mutation is maintained with the hAbeta/APOE4/Trem2*R47H mutations (Stock No. 030670) intended to increase risk of late-onset Alzheimer's disease: a humanized Apoe knock-in mutation (sequence coding for human isoform E4), a CRISPR/Cas9-generated App allele with a humanized Abeta1-42 region (G601R, F606Y, R609H in the mouse gene, corresponding to amino acid positions 676, 681, 684 in the human APP locus) and a CRISPR/Cas9-generated R47H point mutation of the Trem2 gene.
Mike Sasner, The Jackson Laboratory
Genetic Background | Generation |
---|---|
|
Allele Type | Gene Symbol | Gene Name |
---|---|---|
Endonuclease-mediated (Humanized sequence) | Trem2 | triggering receptor expressed on myeloid cells 2 |
Allele Type | Gene Symbol | Gene Name |
---|---|---|
Targeted (Inserted expressed sequence, Humanized sequence) | Apoe | apolipoprotein E |
Allele Type | Gene Symbol | Gene Name |
---|---|---|
Endonuclease-mediated (Humanized sequence) | App | amyloid beta (A4) precursor protein |
Allele Type | Gene Symbol | Gene Name |
---|---|---|
Endonuclease-mediated (Not Specified) | Scimp | SLP adaptor and CSK interacting membrane protein |
Scimp upstream SNP/hAbeta/APOE4/Trem2*R47H quadruple mutant strain carries a mutant allele of the Scimp gene with a T-to-C point mutation (modeling human SNP rs61481506), a humanized ApoE knock-in allele in which exons 2, 3 and most of exon 4 of the mouse Apoe gene were replaced by human APOE4 gene sequence including exons 2, 3 and 4 (and some 3' UTR sequence), a mutant allele of the App gene containing G601R, F606Y and R609H point mutations and a knock-in of a point mutation into mouse Trem2 gene containing an R47H point mutation with two silent mutations.
The targeted Scimp gene encodes a transmembrane adaptor protein that is expressed in antigen-presenting cells. Localized in the immunologic synapse, the encoded protein may also play a role in the onset of Alzheimer's disease. The targeted Apoe gene encodes apolipoprotein E, which is important in lipoprotein metabolism and cardiovascular disease as well as Alzheimer's disease, immunoregulation and cognition. The targeted App gene encodes amyloid beta precursor protein, a transmembrane cell surface receptor that is cleaved by secretases. Mutations in this gene have been associated with Alzheimer's disease. The targeted Trem2 gene (triggering receptor expressed on myeloid cells 2) encodes a protein that is part of a receptor signaling complex with TYRO protein tyrosine kinase binding protein, and that activates macrophages and dendritic cells during immune responses. The TREM2 R47H mutation is a missense mutation in exon 2 that is one of the strongest genetic risk factors for late-onset Alzheimer's disease.
Mice that are homozygous for Scimpem1Adiuj (Scimp upstream SNP), Apoetm1.1(APOE*4)Adiuj (APOE4), Appem1Adiuj (hAbeta) and Trem2em1Adiuj (Trem2*R47H) are viable and fertile [July 2020]. If additional characterization of these Scimp upstream SNP/hAbeta/APOE4/Trem2*R47H mice is performed, we may modify the strain description accordingly.
Of note, in brains of mice homozygous for the Trem2em1Adiuj allele (and not carrying any other mutant alleles), expression of both transcripts of Trem2 is decreased by about 50%. Mice expressing the Trem2 R47H mutation also express a novel splice variant with a deletion of 119bp at the 5' end of exon 2, due to a cryptic splice acceptor site in exon 2 (see Stock No. 027918).
This Scimp upstream SNP/hAbeta/APOE4/Trem2*R47H quadruple mutant line was generated by utilizing CRISPR/Cas9 endonuclease-mediated genome editing of the Scimp gene in C57BL/6J-congenic Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj mice (available as Stock No. 030670).
Stock No. 030670 was generated by utilizing CRISPR/Cas9 endonuclease-mediated genome editing of the App gene in C57BL/6J-congenic Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj mice (available as Stock No. 028709).
For the Apoetm1.1(APOE*4)Adiuj allele (APOE4; available as Stock No. 027894): A targeting vector containing a 3' FRT flanked neo cassette was used to replace exons 2, 3 and most of exon 4 with 1.5 kb of human APOE gene sequence including exons 2, 3 and 4 (and some 3' UTR sequence). The human ApoE sequence also contains a 2 nucleotide A to T substitution in intron 3 for identification of the targeted allele by Southern analysis. The construct was electroporated into C57BL/6J-derived embryonic stem (ES) cells. Correctly targeted ES cells were injected into blastocysts. The resulting chimeric animals were tested for germline transmission by crossing to C57BL/6J. Heterozygous animals were crossed subsequently to FLP recombinase expressing mice (see Stock No. 005703) to remove the FRT site flanked PGK-neo cassette. Mice that no longer contained the FRT flanked PGK-neo cassette were then backcrossed to C57BL/6J at least once to remove the FLP recombinase transgene.
For the Trem2em1Adiuj allele (Trem2*R47H; available as Stock No. 027918): Plasmids encoding a single guide RNA designed to introduce a R47H point mutation, with two silent mutations, into the Trem2 gene and the cas9 nuclease were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well-recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by sequencing and PCR and further bred to C57BL/6J (Stock No. 000664) to develop the colony.
For the Appem1Adiuj allele (hAbeta): Plasmids encoding a single guide RNA designed to introduce the G601R, F606Y, and R609H point mutations into the App gene and the cas9 nuclease were introduced into the cytoplasm of Stock No. 028709-derived fertilized eggs with well recognized pronuclei. G601R corresponds to a GGA to CGA nucleotide change, F606Y represents a TTT to TAT nucleotide mutation, and R609H incorporates a CGC to CAT nucleotide change. Correctly targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by sequencing and PCR and further bred to Stock No. 028709 to develop the colony.
Important note about App isoforms and exon numbering: The App-201 isoform (695 aa protein) is encoded by 16 exons, of which the Abeta sequence is encoded by exon 14. The App-206 isoform (770 aa protein) is encoded by 18 exons, of which the Abeta sequence is encoded by exon 16.
For the Scimpem1Adiuj allele (Scimp upstream SNP): Plasmids encoding a single guide RNA (ACAGGCAAGAGGACAAGTCC) designed to introduce a T-to-C point mutation upstream of Scimp locus and the cas9 nuclease were introduced into the cytoplasm of Stock No. 030670-derived fertilized eggs with well recognized pronuclei. Correctly targeted embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by sequencing and PCR and further bred to Stock No. 030670 to develop the colony.
Expressed Gene | APOE, apolipoprotein E, human |
---|---|
Site of Expression | |
Site of Expression | |
Site of Expression |
Allele Name | endonuclease-mediated mutation 1, MODEL-AD Center |
---|---|
Allele Type | Endonuclease-mediated (Humanized sequence) |
Allele Synonym(s) | Jax R27H ki; Trem2 R47H KI |
Gene Symbol and Name | Trem2, triggering receptor expressed on myeloid cells 2 |
Gene Synonym(s) | |
Strain of Origin | C57BL/6J |
Chromosome | 17 |
Molecular Note | The allele was generated by injecting cas9 nuclease and a single guide RNA designed to introduce a R47H point mutation with two silent mutations (lysine AAG>AAA and alanine GCC>GCA) into the gene. |
Allele Name | targeted mutation 1.1, MODEL-AD Center |
---|---|
Allele Type | Targeted (Inserted expressed sequence, Humanized sequence) |
Allele Synonym(s) | APOEepsilon4 |
Gene Symbol and Name | Apoe, apolipoprotein E |
Gene Synonym(s) | |
Expressed Gene | APOE, apolipoprotein E, human |
Strain of Origin | C57BL/6J |
Chromosome | 7 |
Molecular Note | The targeting vector contains a 3' FRT flanked neo cassette and 1.5 kb of human APOE gene sequence including exons 2, 3, 4 and a portion of the 3'UTR sequence (the APOE4 isoform) which is used to replace exons 2, 3 and most of exon 4 of the endogenous sequence. The human ApoE sequence carries a 2 nucleotide A to T substitution in intron 3. Flp-mediated recombination removed the FRT-flanked neo cassette. |
Allele Name | endonuclease-mediated mutation 1, MODEL-AD Center |
---|---|
Allele Type | Endonuclease-mediated (Humanized sequence) |
Allele Synonym(s) | |
Gene Symbol and Name | App, amyloid beta (A4) precursor protein |
Gene Synonym(s) | |
Strain of Origin | B6(SJL)-Apoetm1.1(APOE*4)Adiuj Trem2em1Adiuj/J |
Chromosome | 16 |
Molecular Note | CRISPR/Cas9 genome editing methodologies are used to introduce G601R, F606Y, and R609H point mutations into the App gene. G601R corresponds to a GGA to CGA nucleotide change, F606Y represents a TTT to TAT change, and R609H incorporates a CGC to CAT nucleotide change. |
Allele Name | endonuclease-mediated mutation 1, MODEL-AD Center |
---|---|
Allele Type | Endonuclease-mediated (Not Specified) |
Allele Synonym(s) | |
Gene Symbol and Name | Scimp, SLP adaptor and CSK interacting membrane protein |
Gene Synonym(s) | |
Strain of Origin | B6.Cg-Apoetm1.1(APOE*4)Adiuj Appem1Adiuj Trem2em1Adiuj/J |
Chromosome | 11 |
Molecular Note | CRISPR/Cas9 genome editing using a single guide RNA (ACAGGCAAGAGGACAAGTCC) is designed to introduce a T-to-C point mutation upstream of the gene locus. |
When maintaining a live colony, mice homozygous for Apoetm1.1(APOE*4)Adiuj (APOE4), Scimpem1Adiuj (Scimp upstream SNP), Appem1Adiuj (hAbeta) and Trem2em1Adiuj (Trem2*R47H) may be bred together as they are viable and fertile. [July 2020]
When using the Scimp upstream SNP/hAbeta/APOE4/Trem2*R47H mouse strain in a publication, please cite the originating article(s) and include JAX stock #032775 in your Materials and Methods section.
Facility Barrier Level Descriptions
Service/Product | Description | Price |
---|---|---|
Homozygous for Apoe<tm1.1(APOE*4)Adiuj>, heterozygous or wildtype for Scimp<em1Adiuj>, homozygous for App<em1Adiuj>, homozygous for Trem2<em1Adiuj> |
Terms are granted by individual review and stated on the customer invoice(s) and account statement. These transactions are payable in U.S. currency within the granted terms. Payment for services, products, shipping containers, and shipping costs that are rendered are expected within the payment terms indicated on the invoice or stated by contract. Invoices and account balances in arrears of stated terms may result in The Jackson Laboratory pursuing collection activities including but not limited to outside agencies and court filings.
The Jackson Laboratory has rigorous genetic quality control and mutant gene genotyping programs to ensure the genetic background of JAX® Mice strains as well as the genotypes of strains with identified molecular mutations. JAX® Mice strains are only made available to researchers after meeting our standards. However, the phenotype of each strain may not be fully characterized and/or captured in the strain data sheets. Therefore, we cannot guarantee a strain's phenotype will meet all expectations. To ensure that JAX® Mice will meet the needs of individual research projects or when requesting a strain that is new to your research, we suggest ordering and performing tests on a small number of mice to determine suitability for your particular project. We do not guarantee breeding performance and therefore suggest that investigators order more than one breeding pair to avoid delays in their research.
What information were you hoping to find through your search?
How easy was it to find what you were looking for?
We may wish to follow up with you. Enter your email if you are happy for us to connect and reachout to you with more questions.
Please Enter a Valid Email Address
Thank you for sharing your feedback! We are working on improving the JAX Mice search. Come back soon for exciting changes.