C57BL/6NJ-Acod1^em1(IMPC)J/J

Stock number: 029340
Strain synonyms: C57BL/6N-Acod1^em1(IMPC)J/J

Description

This CRISPR-generated knock-out mutant of the aconitate decarboxylase 1 (Acod1) gene has been generated by the Knockout Mouse Phenotyping Program (KOMP²) at The Jackson Laboratory. Acod1 gene encodes a protein that acts as a negative regulator of the Toll-like receptors (TLRs)-mediated inflammatory innate response.

Detailed description

This strain was generated by the Knockout Mouse Phenotyping Program (KOMP²) at The Jackson Laboratory using CRISPR technology. The targeted gene, aconitate decarboxylase 1 (Acod1) gene encodes a protein that acts as a negative regulator of the Toll-like receptors (TLRs)-mediated inflammatory innate response. The alteration resulted in the deletion of 370 bp, which should result in the deletion of exon 4, amino acid change after residue 88 and early truncation 49 amino acids later. As mice are characterized, phenotype data will be accessible on the International Mouse Phenotyping Consortium website.

Development

Guide RNAs (CAACGATTCTGACAATTTGG, TGAAATTATACCCTAAAAAT, GCAGTGTCGCTTTCCTTGAT and TCGCTTTCCTTGATGGGCAC), designed to delete 370 bp in exon 4 of the aconitate decarboxylase 1 (Acod1) gene, and Cas9 nuclease were introduced into C57BL/6NJ-derived fertilized eggs with well recognized pronuclei. Embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by PCR and further bred to C57BL/6NJ (Stock No. 005304) to develop the colony.

Allele

Symbol: Acod1^em1(IMPC)J
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:5775820
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: Acod1^em1J
Marker symbol: Acod1
Marker name: aconitate decarboxylase 1
Marker synonyms: CAD; IRG1; RGD1563454
Chromosome: 14
Strain of origin: C57BL/6NJ
Molecular note: This allele from project Acod1-7676J-M9515 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAACGATTCTGACAATTTGG, TGAAATTATACCCTAAAAAT, GCAGTGTCGCTTTCCTTGAT and TCGCTTTCCTTGATGGGCAC, which resulted in a 370 bp deletion spanning exon 4 beginning at Chromosome 14 positive strand position 103,051,188 bp, ATTTTTAGGGTATAATTTCA, and ending after TGTGCCCATCAAGGAAAGCG at 103,051,557 bp (GRCm38/mm10). This mutation deletes exon 4 and 164 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 49 amino acids later.