NOD/ShiLtDvs-H2-D1^em4Dvs/Dvs

Stock number: 028749

Development

This null allele was generated by injection of Cas9 RNA and the guide sequence GTACCGGGGCTCCTCGAGGC into NOD/ShiLtDvs embryos. A male founder was backcrossed to a NOD/ShiLtDvs female to isolate this mutation from any other and the progeny were sibling intercrossed for a few generations to obtain a homozygous line. This mutation was maintained coisogenic on this background, and sperm was cryopreserved from homozygous males. Standard cryo-recovery is scheduled to use the NOD/ShiLtJ subline, not the NOD/ShiLtDvs subline (Simecek et al, 2015).

Allele

Symbol: H2-D1^em4Dvs
Name: endonuclease-mediated mutation 4, David V Serreze
MGI accession ID: MGI:6118903
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: H2-D1
Marker name: histocompatibility 2, D region locus 1
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: This endonuclease-mediated single nucleotide deletion of T in exon 2 is predicted to produce an early stop codon and flow cytometry proved the absence of H2-D1^b