NOD/ShiLtDvs-H2-D1^b-em4Dvs/Dvs

Stock number: 028749

Development

This null allele was generated by injection of Cas9 RNA and the guide sequence GTACCGGGGCTCCTCGAGGC into NOD/ShiLtDvs embryos. A male founder was backcrossed to a NOD/ShiLtDvs female to isolate this mutation from any other and the progeny were sibling intercrossed for a few generations to obtain a homozygous line. This mutation was maintained coisogenic on this background, and sperm was cryopreserved from homozygous males. Standard cryo-recovery will use oocytes from the NOD/ShiLtJ subline, not the NOD/ShiLtDvs subline (Simecek et al, 2015) so the recovered pups will be segregating for Icam2^m1Dvs and any other allelic variant between the NOD/ShiLtDvs and NOD/ShiLtJ sublines.

Allele

Symbol: H2-D1^b-em4Dvs
Name: endonuclease-mediated mutation 4, David V Serreze
MGI accession ID: MGI:6118903
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Synonyms: H2-D^-
Marker symbol: H2-D1
Marker name: histocompatibility 2, D region locus 1
Marker synonyms: AS; B-4901; CDA12; D6S204; H-2D; HLA-5.4; HLA-6.2; HLAA; HLAB; HLAC; HLA-CDA12; HLAF; HLAHP; HLA-JY3; HLC-C; MHC; MHC-G; PSORS1; QA1; RT1.A1(N); RT1.A2(N); RT1A-1; RT1-A1n; RT1A-2; RT1-A2n; RT1-C/E1; RT1-C/E3; RT1-C/E4; RT1-C/E5; RT1-C/E7; RT1-CE12; RT1-CE7; RT1-E2; rt1-El
Chromosome: 17
Strain of origin: NOD/ShiLtDvs
Molecular note: This endonuclease-mediated single nucleotide deletion of T in exon 2 is predicted to produce an early stop codon and flow cytometry proved the absence of H2-D1^b