C57BL/6-Rmrp^em1Litt/J

Stock number: 028282
Product name: Rmrp^G270T
Research areas: Immunology, Inflammation and Autoimmunity Research

Description

This CRISPR/Cas9-generated mutant of Rmrp (RNA component of mitochondrial RNAase P) carries a G270T point mutation corresponding to an allele identified in cartilage-hair hypoplasia (CHH) patients.

Detailed description

These mutant Rmrp (RNA component of mitochondrial RNAase P) mice, generated using CRISPR-Cas9 technology, carry a single nucleotide change (270G>T) corresponding to an allele identified in cartilage-hair hypoplasia (CHH) patients (262G>T). Expression levels of mutant Rmrp RNA in T cells are similar to those found in wildtype animals. Mice are born at expected Mendelian ratios and have no overt phenotype.

Sorted naive CD4⁺ T cells have altered gene expression profiles when cultured under T_H17-polarizing conditions (in the presence of IL6 and TGFB). T cells from homozygotes have lower pathogenic potential when administered to Rag2-deficient mice in an adoptive transfer model of colitis. Recipients of mutant cells experienced reduced colitis as determined by weight loss and histology.

Development

C57BL/6 zygotes were injected with guide RNA (sgRNA_Rmrp_Locus: CACGGGGCTCATTCTCAGCG) and cas9 nuclease. The cleavage site was repaired by an endogenous oligo donor to create a G270T nucleotide replacement/knock-in. This strain was created and maintained on a C57BL/6NTac background by the donating investigator. Stocks will be cryorecovered/rederived using C57BL/6NJ mice.

Allele

Symbol: Rmrp^em1Litt
Name: endonuclease-mediated mutation 1, Dan R Littman
MGI accession ID: MGI:5755455
Generation method: Endonuclease-mediated
Attributes: Humanized sequence
Marker symbol: Rmrp
Marker name: RNA component of mitochondrial RNAase P
Chromosome: 4
Strain of origin: C57BL/6NTac
Molecular note: This allele was generated by injecting Cas9 RNA and guide RNA (sgRNA_Rmrp_Locus: CACGGGGCTCATTCTCAGCG), resulting in a single nucleotide change (270G>T) corresponding to an allele identified in cartilage-hair hypoplasia (CHH) patients (262G>T). Expression levels of mutant Rmrp RNA in T cells are similar to those found in wildtype animals.