B6;129-Gt(ROSA)26Sor^{tm9(CAG-GFP*)Nat}/J

Stock number: 026005
Product name: R26 mLSL-nGFP
Research areas: Research Tools

Description

This reduced recombination, nuclear-localized GFP reporter strain (R26 mLSL-nGFP) enables extremely sparse cre-mediated labeling of cells and is appropriate for applications such as lineage tracing.

Detailed description

Gt(ROSA)26Sor (R26) mLSL-nGFP mice incorporate a nuclear-localization signal (nls)-GFP open reading frame inserted downstream of a loxP-stop-loxP cassette in which one loxP site is wild type and the other is mutant loxP63 (mutant-LSL or "mLSL"). The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences.

When crossed with Cre-expressing strains, the result is reduced efficiency of Cre-mediated recombination. There is no background recombination in the absence of 4-hydroxytamoxifen (4HT) when tested with typical CreER lines. These mice will be useful for applications that require extremely sparse labeling, such as lineage tracing. Mice homozygous for this allele are viable and fertile with no obvious physical or behavioral abnormalities.

Development

A targeting vector containing (from 5' to 3') a CAG promoter, a mutant loxP63 (ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized GFP with a C-terminal 6-Myc epitope tag, a bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette was inserted into the Gt(ROSA)26Sor locus. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences. The construct was electroporated into 129-derived ES cells. Correctly targeted ES cells were injected into C57BL/6 blastocysts. Resulting chimeric males were crossed to C57BL/6 mice for two generations by the donating laboratory.

Allele

Symbol: Gt(ROSA)26Sor^{tm9(CAG-GFP*)Nat}
Name: targeted mutation 9, Jeremy Nathans
MGI accession ID: MGI:5578178
Generation method: Targeted
Attributes: Conditional ready (e.g. floxed); Reporter
Synonyms: R26 mLSL-nGFP
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: 129
Expressed genes: GFP,Green Fluorescent Protein,
Site of expression: Upon induction with 4-hydroxytamoxifen (4HT) GFP is observed in Cre-expressing tissues.
Molecular note: The targeting vector containins (from 5' to 3') a CAG promoter, a mutant loxP63 (ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized GFP with a C-terminal 6-myc epitope tag, a bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences.