C57BL/6NJ-Tyr^em3J/GrsrJ

Stock number: 021999

Description

This strain provides albino mice on a pure C57BL/6NJ background.

Detailed description

Mice homozygous for the Tyr^em3J mutation are albino, with a white coat and red eyes. They have a normal lifespan and fertility compared with the parental C57BL/6NJ strain.

Development

This zinc finger induced mutation was generated in C57BL/6NJ one cell embryos and a founder male was bred to C57BL/6NJ females and their offspring were bred to C57BL/6NJ and their offspring were sibling intercrossed at each subsequent generation to generate this line, number 103, that is homozygous for the Tyr^em3J mutation, and 8 amino acid in-frame deletion near the middle of the di-copper centre-containing domain.

Allele

Symbol: Tyr^em3J
Name: endonuclease-mediated mutation 3, Jackson
MGI accession ID: MGI:5470270
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Tyr
Marker name: tyrosinase
Chromosome: 7
Strain of origin: C57BL/6NJ
Molecular note: This zinc finger mediated allele was generated at The Jackson Laboratory and is a 24 bp deletion of AGGGACCACTATTACGTAATCCTG from Chromosome 7 negative strand position 87,483,953 bp through 87,483,976 bp (GRCm38/mm10), which results in a recessive albino phenotype. This is predicted to cause an 8 amino acid in-frame deletion of amino acids 295-302, GPLLRNPG, near the center of the di-copper centre-containing domain, but is not predicted to cause a premature truncation or frameshift.