This strain provides albino mice on a pure C57BL/6NJ background.
Read More +Genetic Background | Generation |
---|---|
005304 C57BL/6NJ |
N2F7
|
Allele Type | Gene Symbol | Gene Name |
---|---|---|
Endonuclease-mediated (Null/Knockout) | Tyr | tyrosinase |
This strain is homozygous for Crb1rd8, the retinal degeneration 8 mutation.
Mice homozygous for the Tyrem3J mutation are albino, with a white coat and red eyes. They have a normal lifespan and fertility compared with the parental C57BL/6NJ strain.
This zinc finger induced mutation was generated in C57BL/6NJ one cell embryos and a founder male was bred to C57BL/6NJ females and their offspring were bred to C57BL/6NJ and their offspring were sibling intercrossed at each subsequent generation to generate this line, number 103, that is homozygous for the Tyrem3J mutation, and 8 amino acid in-frame deletion near the middle of the di-copper centre-containing domain.
Allele Name | endonuclease-mediated mutation 3, Jackson |
---|---|
Allele Type | Endonuclease-mediated (Null/Knockout) |
Allele Synonym(s) | |
Gene Symbol and Name | Tyr, tyrosinase |
Gene Synonym(s) | |
Strain of Origin | C57BL/6NJ |
Chromosome | 7 |
Molecular Note | This zinc finger mediated allele was generated at The Jackson Laboratory and is a 24 bp deletion of AGGGACCACTATTACGTAATCCTG from Chromosome 7 negative strand position 87,483,953 bp through 87,483,976 bp (GRCm38/mm10), which results in a recessive albino phenotype. This is predicted to cause an 8 amino acid in-frame deletion of amino acids 295-302, GPLLRNPG, near the center of the di-copper centre-containing domain, but is not predicted to cause a premature truncation or frameshift. |
When using the C57BL/6NJ-Tyrem3J/GrsrJ mouse strain in a publication, please cite the originating article(s) and include JAX stock #021999 in your Materials and Methods section.
Facility Barrier Level Descriptions
AX9 (Standard) |
Service/Product | Description | Price |
---|---|---|
Heterozygous for Tyr<em3J> |
Frozen Mouse Embryo | C57BL/6NJ-Tyr<em3J>/GrsrJ | $2595.00 |
Frozen Mouse Embryo | C57BL/6NJ-Tyr<em3J>/GrsrJ | $2595.00 |
Frozen Mouse Embryo | C57BL/6NJ-Tyr<em3J>/GrsrJ | $3373.50 |
Frozen Mouse Embryo | C57BL/6NJ-Tyr<em3J>/GrsrJ | $3373.50 |
Terms are granted by individual review and stated on the customer invoice(s) and account statement. These transactions are payable in U.S. currency within the granted terms. Payment for services, products, shipping containers, and shipping costs that are rendered are expected within the payment terms indicated on the invoice or stated by contract. Invoices and account balances in arrears of stated terms may result in The Jackson Laboratory pursuing collection activities including but not limited to outside agencies and court filings.
The Jackson Laboratory has rigorous genetic quality control and mutant gene genotyping programs to ensure the genetic background of JAX® Mice strains as well as the genotypes of strains with identified molecular mutations. JAX® Mice strains are only made available to researchers after meeting our standards. However, the phenotype of each strain may not be fully characterized and/or captured in the strain data sheets. Therefore, we cannot guarantee a strain's phenotype will meet all expectations. To ensure that JAX® Mice will meet the needs of individual research projects or when requesting a strain that is new to your research, we suggest ordering and performing tests on a small number of mice to determine suitability for your particular project. We do not guarantee breeding performance and therefore suggest that investigators order more than one breeding pair to avoid delays in their research.
What information were you hoping to find through your search?
How easy was it to find what you were looking for?
We may wish to follow up with you. Enter your email if you are happy for us to connect and reachout to you with more questions.
Please Enter a Valid Email Address
Thank you for sharing your feedback! We are working on improving the JAX Mice search. Come back soon for exciting changes.