The transgene in these mice is primarily expressed in olfactory sensory neurons that co-express class II olfactory receptors.
Peter Mombaerts, Max Planck Research Unit for Neurogenetics
Genetic Background | Generation |
---|---|
|
Allele Type |
---|
Transgenic (Reporter) |
The Tg(P-taulacZ)13Mom transgene is expressed in approximately 10% of olfactory sensory neurons, which are also expected to co-express an endogenous olfactory receptor. This transgene is preferentially expressed in olfactory sensory neurons that co-express class II olfactory receptors, with a 100-fold lower expression found in class I expressing neurons. Immunohistochemistry shows expression in NCAM2 staining glomeruli, which are generally dorsally projecting, and a ventral subset of NQO1 staining glomeruli, which are generally ventrally projecting. Expression is absent in glomeruli in the dorsal-medial and anterior-dorsal olfacotry bulb giving an unlabeled butterfly-shaped pattern in a dorsal view.
A 317 base pair regulatory sequence, P, excised from between the Olfr713 and Olfr714 genes was placed upstream of a taulacZ cassette and this construct was microinjected into the pronuclei of (CBA x C57BL/6J)F2 fertilized eggs. The founders were subsequently bred to C57BL/6J. The 317 base pair regulatory sequence is tccctgtgcagcagagtagctcattaacaactttttaatgaagtcacagatagtgactgctcattaataaatttattagtctgcagccccagagattaaagaaactgaaaacagaagtcagtgacaacagtgtttagccagagtagctgcatcagagtgaaaagagggaacttctcttggcagactctgaaacttttactgttggacctctagggtccttgcaggtcccagaaactgtaattctgaaaatagaaacctggggggactaagaacttgatgggatgaaggaaaaacagagccaaatgatcccaggcttg
Expressed Gene | lacZ, beta-galactosidase, E. coli |
---|---|
Site of Expression | lacZ is expressed in olfactory sensory neurons. |
Allele Name | transgene insertion 13, Peter Mombaerts |
---|---|
Allele Type | Transgenic (Reporter) |
Allele Synonym(s) | P-LacZ-Tg, line 13 |
Gene Symbol and Name | Tg(P-taulacZ)13Mom, transgene insertion 13, Peter Mombaerts |
Gene Synonym(s) | |
Promoter | Olfr714, olfactory receptor 714, mouse, laboratory |
Promoter | Olfr713, olfactory receptor 713, mouse, laboratory |
Expressed Gene | lacZ, beta-galactosidase, E. coli |
Site of Expression | lacZ is expressed in olfactory sensory neurons. |
Strain of Origin | (CBA x C57BL/6J)F2 |
Chromosome | UN |
Molecular Note | A 317 nucleotide sequence from between Olfr713 and Olfr714, which has homology with the a sequence in the Olfr713 promoter, was placed upstream of a taulacZ cassette and this construct was microinjected into the pronuclei of (CBA x C57BL/6J)F2 fertilized eggs. Expression from this transgenic insertion is 2 to 3 times higher than the normal expression of an olfactory receptor gene, with expression found in as many as 10% of olfactory sensory neruons. |
When using the P-LacZ-Tg, line 13 mouse strain in a publication, please cite the originating article(s) and include JAX stock #006793 in your Materials and Methods section.
Facility Barrier Level Descriptions
Service/Product | Description | Price |
---|---|---|
Carrier of Tg(P-taulacZ)13Mom |
Frozen Mouse Embryo | B6;CBA-Tg(P-taulacZ)13Mom/MomJ Frozen Embryo | $2595.00 |
Frozen Mouse Embryo | B6;CBA-Tg(P-taulacZ)13Mom/MomJ Frozen Embryo | $2595.00 |
Frozen Mouse Embryo | B6;CBA-Tg(P-taulacZ)13Mom/MomJ Frozen Embryo | $3373.50 |
Frozen Mouse Embryo | B6;CBA-Tg(P-taulacZ)13Mom/MomJ Frozen Embryo | $3373.50 |
Terms are granted by individual review and stated on the customer invoice(s) and account statement. These transactions are payable in U.S. currency within the granted terms. Payment for services, products, shipping containers, and shipping costs that are rendered are expected within the payment terms indicated on the invoice or stated by contract. Invoices and account balances in arrears of stated terms may result in The Jackson Laboratory pursuing collection activities including but not limited to outside agencies and court filings.
The Jackson Laboratory has rigorous genetic quality control and mutant gene genotyping programs to ensure the genetic background of JAX® Mice strains as well as the genotypes of strains with identified molecular mutations. JAX® Mice strains are only made available to researchers after meeting our standards. However, the phenotype of each strain may not be fully characterized and/or captured in the strain data sheets. Therefore, we cannot guarantee a strain's phenotype will meet all expectations. To ensure that JAX® Mice will meet the needs of individual research projects or when requesting a strain that is new to your research, we suggest ordering and performing tests on a small number of mice to determine suitability for your particular project. We do not guarantee breeding performance and therefore suggest that investigators order more than one breeding pair to avoid delays in their research.
What information were you hoping to find through your search?
How easy was it to find what you were looking for?
We may wish to follow up with you. Enter your email if you are happy for us to connect and reachout to you with more questions.
Please Enter a Valid Email Address
Thank you for sharing your feedback! We are working on improving the JAX Mice search. Come back soon for exciting changes.