Jackson Laboratory SEARCH FOR MICE
B6.RHJ-Cnga3cpfl5/BocJ
Stock No: 005978
  • Congenic
  • Spontaneous Mutation
Contact Customer Service
Contact Customer Service
  • Email
  • Download PDF
  • Print
  • Help
  • Overview
  • Details
    • Detailed Description
    • Development
    • Control Suggestions
  • Genetics
  • Disease/Phenotype
    • Disease Terms
    • Research Areas By Phenotype
    • Mammalian Phenotype Terms by Genotype
    • References
  • Technical Support
    • Genotyping Protocols
    • Mating System
    • Breeder Pairs
    • Citation
    • Animal Health Reports
    • Contact Technical Support
  • Pricing & Availability
    • Price
    • Payment Terms
  • Terms Of Use
  • Related Strains

Overview

This spontaneous point transition, causing a substitution of alanine for threonine, provides a model for complete achromatopsis. Cone responses are lost but scotopic ERGs show sensitive rod responses.

Read More +

Genetic overview

Genetic Background Generation
000664 C57BL/6J
N6F23
(2020-04-23 00:00:00)

Cnga3cpfl5

Allele Type Gene Symbol Gene Name
Spontaneous Cnga3 cyclic nucleotide gated channel alpha 3
View Genetics

Research Applications

  • Sensorineural Research
View All Research Applications

Base Price

Starting at:

$242.59 Domestic price for female
View Price List

Details

Detailed Description

Retinal staining of homozygotes with PNA at five months of age showed moderate cone loss in the cone outer segment, primarily in the ventral and nasal regions of the retina. Immunohistochemistry at three weeks of age showed normal M-opsin expression but diminished S-opsin expression, and by ten weeks of age no S-opsin staining and the M-opsin expression was mislocalized to the inner segment, cone nuclei and cone pedicles, consistent with early S-cone cell degeneration. By 5.5 months M-opsin was found in the superior retinal hemisphere but rarely found in the inferior hemisphere of homozygotes. Homozygotes were found to have decreased visual acuity and contrast sensitivity, as assessed at 5.5 months of age. At 5 weeks of age, no b-wave response was found in light-adapted ERG, and the b-wave amplitude in dark-adapted ERG was decreased, although statistically similar in amplitudes to that of C57BL/6J controls. Additionally, rod-mediated ERG responses were found to be lower than normal at 5.5 months of age. This homozygote provides a model for complete achromatopsis and AAV5-CBA-mCnga3-mediated gene replacement therapy initiated at 2 weeks of age has been shown to significantly improve these phenotypes (Pang et al., 2012). Because this mutation is an A to G substitution in exon 5 that generates a new SmaI site, PCR-RFLP can be used to genotype for this mutant allele. Primer pair CCTGGACTAGTCTGCAGATG and TGGACCAGTCAAGTCCGTGG will generate a PCR product that can be digested with SmaI to generate two bands, 53 and 37 bp, from mutant sequence and a single band, 90 bp, from wild-type sequence. Heterozygotes will generate all three bands. Protocol details can be obtained from Dr. Bo Chang.

Development

The mutation cone photoreceptor function loss 5 (cpfl5) arose spontaneously in the strain RHJ/LeJ-stpm/J and was identified in 2004. The cpfl5 mutation was crossed onto C57BL/6J via backcross-intercross, reaching backcross generation N5 before the colony was maintained by sibling mating. In this process the stpm mutation was bred out of the line.

Control Suggestions

  • 000664 C57BL/6J

Additional Information

  • Considerations for Choosing Controls

Genetics

Cnga3cpfl5

Allele Symbol: Cnga3cpfl5

Allele Name cone photoreceptor function loss 5
Allele Type Spontaneous
Allele Synonym(s)
Gene Symbol and Name Cnga3, cyclic nucleotide gated channel alpha 3
Gene Synonym(s)
Strain of Origin Not Specified
Chromosome 1
Molecular Note Sequence analysis of this spontaneous phenotypic mutation identified a single A to G substitution at Chr1: 37,258,096 (GRCm38.p6, sequence ATGCTGGTTCGAGCCCGG(A-to-G)CA) which changes codon ACA to GCA in exon 5, changing amino acid 165 from threonine to alanine (p.T165A).

Disease/Phenotype

Disease Terms

Model with phenotypic similarity to human disease where etiologies involve orthologs. Human genes are associated with this disease. Orthologs of those genes appear in the mouse genotype(s).

  • achromatopsia 2

Research Areas By Phenotype

This mouse can be used to support research in many areas including:

Genotype: Cnga3cpfl5 related

  • Sensorineural Research
    • Eye Defects

Mammalian Phenotype Terms by Genotype

The following phenotype information is associated with a similar, but not exact match to this JAX® Mice strain

Genotype: Cnga3cpfl5/Cnga3cpfl5
involves: RHJ/LeJ

nervous system phenotype

  • abnormal retinal cone cell morphology
    • migration of the cone somata into the outer plexiform layer of the retina is observed as early as postnatal week 3
    • (MGI Ref ID J:167197)

vision/eye phenotype

  • abnormal cone electrophysiology
    • no cone ERG response
    • (MGI Ref ID J:167197)(MGI Ref ID J:166679)
  • abnormal retinal cone cell morphology
    • migration of the cone somata into the outer plexiform layer of the retina is observed as early as postnatal week 3
    • (MGI Ref ID J:167197)
The following phenotype relates to a compound genotype created using this strain

Genotype: Cnga3cpfl5/Cnga3cpfl5
B6.RHJ-Cnga3/BocJ

vision/eye phenotype

  • retinal cone cell degeneration
    • by 3 weeks of age S-opsin immunostaining of the retina is decreased, by 5 weeks of age PNA staining of retinal sections shows decreased cone densities outside the superior hemisphere, primarily in the nasal inferior quadrant, consistent with loss of S-cones, and by 10 weeks of age no S-opsin staining is found
    • (MGI Ref ID J:187090)
    • at 3 weeks of age staining intensity and localization of M-opsin is normal in immunohistochemistry of retinal sections, but by 10 weeks of age M-opsin is found mislocalized to cone inner segments, nuclei, and synaptic termini
    • (MGI Ref ID J:187090)
  • abnormal retinal cone cell outer segment morphology
    • moderate cone loss in the outer segment by 5 months of age
    • (MGI Ref ID J:187090)
  • decreased b-wave amplitude
    • at 5.5 months of age rod-mediated ERG responses at 0.43 log cd-s per m2 are lower than that of C57BL/6J controls
    • (MGI Ref ID J:187090)
    • light-adapted single stimulus ERG at either 1.08 or 0.65 log cd-s/m2 at 5 weeks of age gave no b-wave, consistent with retinal cone cell degeneration
    • (MGI Ref ID J:187090)
  • abnormal visual contrast sensitivity
    • contrast sensitivities tested at a spatial frequency of 0.256 cycles/degree at 5.5 months of age are decreased relative to C57BL/6J controls
    • (MGI Ref ID J:187090)
  • decreased visual acuity
    • optomoter behavioral analysis shows decreased visual acuities of 0.273 cycles per degree at 5.5 months of age
    • (MGI Ref ID J:187090)
  • photoreceptor outer segment degeneration
      (MGI Ref ID J:187090)

nervous system phenotype

  • photoreceptor outer segment degeneration
      (MGI Ref ID J:187090)
  • retinal cone cell degeneration
    • at 3 weeks of age staining intensity and localization of M-opsin is normal in immunohistochemistry of retinal sections, but by 10 weeks of age M-opsin is found mislocalized to cone inner segments, nuclei, and synaptic termini
    • (MGI Ref ID J:187090)
    • by 3 weeks of age S-opsin immunostaining of the retina is decreased, by 5 weeks of age PNA staining of retinal sections shows decreased cone densities outside the superior hemisphere, primarily in the nasal inferior quadrant, consistent with loss of S-cones, and by 10 weeks of age no S-opsin staining is found
    • (MGI Ref ID J:187090)
  • abnormal retinal cone cell outer segment morphology
    • moderate cone loss in the outer segment by 5 months of age
    • (MGI Ref ID J:187090)

References

Additional - Cnga3cpfl5 related

Technical Support

CONTACT TECHNICAL SUPPORT
  • Genotyping Protocols

    • Genotyping resources and troubleshooting
  • Mating System

    • Homozygote x Homozygote
  • Citation

    When using the B6.RHJ-Cnga3cpfl5/BocJ mouse strain in a publication, please cite the originating article(s) and include JAX stock #005978 in your Materials and Methods section.

Animal Health Reports

Facility Barrier Level Descriptions

MGL277 (Low)

Pricing & Availability

Availability Varies
  • Domestic
  • International

Live Mouse

Age Genotype Price
weeks

Cryorecovery - Pricing

Service/Product Description Price
Please inquire

Payment Terms and Conditions

Terms are granted by individual review and stated on the customer invoice(s) and account statement. These transactions are payable in U.S. currency within the granted terms. Payment for services, products, shipping containers, and shipping costs that are rendered are expected within the payment terms indicated on the invoice or stated by contract. Invoices and account balances in arrears of stated terms may result in The Jackson Laboratory pursuing collection activities including but not limited to outside agencies and court filings.

The Jackson Laboratory's Genotype Promise

The Jackson Laboratory has rigorous genetic quality control and mutant gene genotyping programs to ensure the genetic background of JAX® Mice strains as well as the genotypes of strains with identified molecular mutations. JAX® Mice strains are only made available to researchers after meeting our standards. However, the phenotype of each strain may not be fully characterized and/or captured in the strain data sheets. Therefore, we cannot guarantee a strain's phenotype will meet all expectations. To ensure that JAX® Mice will meet the needs of individual research projects or when requesting a strain that is new to your research, we suggest ordering and performing tests on a small number of mice to determine suitability for your particular project. We do not guarantee breeding performance and therefore suggest that investigators order more than one breeding pair to avoid delays in their research.

Terms Of Use

Terms Of Use

General Terms and Conditions

Questions about Terms of Use

Licensing Information

Phone: 207-288-6470
Email: TechTran@jax.org

Related Strains

  • All
  • By Allele
  • By Gene
  • By Collection
View All Strains
There are no related strains using this filter.
▲
  • Stock No: |
    Related By:
▼
FEEDBACK
Did you find what you were looking for?

What information were you hoping to find through your search?

How easy was it to find what you were looking for?

We may wish to follow up with you. Enter your email if you are happy for us to connect and reachout to you with more questions.

Please Enter a Valid Email Address

Skip

Thank you for sharing your feedback! We are working on improving the JAX Mice search. Come back soon for exciting changes.