Overview

This spontaneous point transition, causing a substitution of alanine for threonine, provides a model for complete achromatopsis. Cone responses are lost but scotopic ERGs show sensitive rod responses.

Genetic overview

Genetic Background	Generation
000664 C57BL/6J	N6F23 (2020-04-23 00:00:00)

Cnga3^cpfl5

Allele Type	Gene Symbol	Gene Name
Spontaneous	Cnga3	cyclic nucleotide gated channel alpha 3

View Genetics

Research Applications

Sensorineural Research

View All Research Applications

Base Price

Starting at:

$242.59 Domestic price for female

View Price List

Details

Detailed Description

Retinal staining of homozygotes with PNA at five months of age showed moderate cone loss in the cone outer segment, primarily in the ventral and nasal regions of the retina. Immunohistochemistry at three weeks of age showed normal M-opsin expression but diminished S-opsin expression, and by ten weeks of age no S-opsin staining and the M-opsin expression was mislocalized to the inner segment, cone nuclei and cone pedicles, consistent with early S-cone cell degeneration. By 5.5 months M-opsin was found in the superior retinal hemisphere but rarely found in the inferior hemisphere of homozygotes. Homozygotes were found to have decreased visual acuity and contrast sensitivity, as assessed at 5.5 months of age. At 5 weeks of age, no b-wave response was found in light-adapted ERG, and the b-wave amplitude in dark-adapted ERG was decreased, although statistically similar in amplitudes to that of C57BL/6J controls. Additionally, rod-mediated ERG responses were found to be lower than normal at 5.5 months of age. This homozygote provides a model for complete achromatopsis and AAV5-CBA-mCnga3-mediated gene replacement therapy initiated at 2 weeks of age has been shown to significantly improve these phenotypes (Pang et al., 2012). Because this mutation is an A to G substitution in exon 5 that generates a new SmaI site, PCR-RFLP can be used to genotype for this mutant allele. Primer pair CCTGGACTAGTCTGCAGATG and TGGACCAGTCAAGTCCGTGG will generate a PCR product that can be digested with SmaI to generate two bands, 53 and 37 bp, from mutant sequence and a single band, 90 bp, from wild-type sequence. Heterozygotes will generate all three bands. Protocol details can be obtained from Dr. Bo Chang.

Development

The mutation cone photoreceptor function loss 5 (cpfl5) arose spontaneously in the strain RHJ/LeJ-stpm/J and was identified in 2004. The cpfl5 mutation was crossed onto C57BL/6J via backcross-intercross, reaching backcross generation N5 before the colony was maintained by sibling mating. In this process the stpm mutation was bred out of the line.

Control Suggestions

000664 C57BL/6J

Additional Information

Considerations for Choosing Controls

Genetics

Cnga3^cpfl5

Allele Symbol: Cnga3^cpfl5

Allele Name	cone photoreceptor function loss 5
Allele Type	Spontaneous
Allele Synonym(s)
Gene Symbol and Name	Cnga3, cyclic nucleotide gated channel alpha 3
Gene Synonym(s)
Strain of Origin	Not Specified
Chromosome	1
Molecular Note	Sequence analysis of this spontaneous phenotypic mutation identified a single A to G substitution at Chr1: 37,258,096 (GRCm38.p6, sequence ATGCTGGTTCGAGCCCGG(A-to-G)CA) which changes codon ACA to GCA in exon 5, changing amino acid 165 from threonine to alanine (p.T165A).

Disease/Phenotype

Disease Terms

Model with phenotypic similarity to human disease where etiologies involve orthologs. Human genes are associated with this disease. Orthologs of those genes appear in the mouse genotype(s).

achromatopsia 2

Research Areas By Phenotype

This mouse can be used to support research in many areas including:

Genotype: Cnga3^cpfl5 related

Sensorineural Research
- Eye Defects

Mammalian Phenotype Terms by Genotype

The following phenotype information is associated with a similar, but not exact match to this JAX^® Mice strain

Genotype: Cnga3^cpfl5/Cnga3^cpfl5
involves: RHJ/LeJ

nervous system phenotype

abnormal retinal cone cell morphology
- migration of the cone somata into the outer plexiform layer of the retina is observed as early as postnatal week 3

vision/eye phenotype

abnormal cone electrophysiology
- no cone ERG response

abnormal retinal cone cell morphology
- migration of the cone somata into the outer plexiform layer of the retina is observed as early as postnatal week 3

The following phenotype relates to a compound genotype created using this strain

Genotype: Cnga3^cpfl5/Cnga3^cpfl5
B6.RHJ-Cnga3/BocJ

nervous system phenotype

abnormal retinal cone cell outer segment morphology
- moderate cone loss in the outer segment by 5 months of age

photoreceptor outer segment degeneration

retinal cone cell degeneration
- at 3 weeks of age staining intensity and localization of M-opsin is normal in immunohistochemistry of retinal sections, but by 10 weeks of age M-opsin is found mislocalized to cone inner segments, nuclei, and synaptic termini
- by 3 weeks of age S-opsin immunostaining of the retina is decreased, by 5 weeks of age PNA staining of retinal sections shows decreased cone densities outside the superior hemisphere, primarily in the nasal inferior quadrant, consistent with loss of S-cones, and by 10 weeks of age no S-opsin staining is found

vision/eye phenotype

abnormal retinal cone cell outer segment morphology
- moderate cone loss in the outer segment by 5 months of age

abnormal visual contrast sensitivity
- contrast sensitivities tested at a spatial frequency of 0.256 cycles/degree at 5.5 months of age are decreased relative to C57BL/6J controls

decreased b wave amplitude
- at 5.5 months of age rod-mediated ERG responses at 0.43 log cd-s per m2 are lower than that of C57BL/6J controls
- light-adapted single stimulus ERG at either 1.08 or 0.65 log cd-s/m2 at 5 weeks of age gave no b-wave, consistent with retinal cone cell degeneration

decreased visual acuity
- optomoter behavioral analysis shows decreased visual acuities of 0.273 cycles per degree at 5.5 months of age

photoreceptor outer segment degeneration

retinal cone cell degeneration
- at 3 weeks of age staining intensity and localization of M-opsin is normal in immunohistochemistry of retinal sections, but by 10 weeks of age M-opsin is found mislocalized to cone inner segments, nuclei, and synaptic termini
- by 3 weeks of age S-opsin immunostaining of the retina is decreased, by 5 weeks of age PNA staining of retinal sections shows decreased cone densities outside the superior hemisphere, primarily in the nasal inferior quadrant, consistent with loss of S-cones, and by 10 weeks of age no S-opsin staining is found

References

Additional - Cnga3^cpfl5 related

Technical Support

CONTACT TECHNICAL SUPPORT

Genotyping Protocols
- Genotyping resources and troubleshooting
Mating System
- Homozygote x Homozygote
Citation
When using the B6.RHJ-Cnga3^cpfl5/BocJ mouse strain in a publication, please cite the originating article(s) and include JAX stock #005978 in your Materials and Methods section.

Animal Health Reports

Facility Barrier Level Descriptions

MGL277 (Low)

Pricing & Availability

Availability Varies

Domestic
International

Live Mouse

Age

Genotype

Price

weeks

Cryorecovery - Pricing

Service/Product	Description	Price
	Please inquire

Payment Terms and Conditions

Terms are granted by individual review and stated on the customer invoice(s) and account statement. These transactions are payable in U.S. currency within the granted terms. Payment for services, products, shipping containers, and shipping costs that are rendered are expected within the payment terms indicated on the invoice or stated by contract. Invoices and account balances in arrears of stated terms may result in The Jackson Laboratory pursuing collection activities including but not limited to outside agencies and court filings.

The Jackson Laboratory's Genotype Promise

The Jackson Laboratory has rigorous genetic quality control and mutant gene genotyping programs to ensure the genetic background of JAX® Mice strains as well as the genotypes of strains with identified molecular mutations. JAX® Mice strains are only made available to researchers after meeting our standards. However, the phenotype of each strain may not be fully characterized and/or captured in the strain data sheets. Therefore, we cannot guarantee a strain's phenotype will meet all expectations. To ensure that JAX® Mice will meet the needs of individual research projects or when requesting a strain that is new to your research, we suggest ordering and performing tests on a small number of mice to determine suitability for your particular project. We do not guarantee breeding performance and therefore suggest that investigators order more than one breeding pair to avoid delays in their research.

Terms Of Use

General Terms and Conditions

Questions about Terms of Use

Licensing Information

Phone: 207-288-6470

Email: TechTran@jax.org

JAX® Mice, Products & Services Conditions of Use

"MICE" means mouse strains, their progeny derived by inbreeding or crossbreeding, unmodified derivatives from mouse strains or their progeny supplied by The Jackson Laboratory ("JACKSON"). "PRODUCT(S)" means biological materials supplied by JACKSON, and their derivatives. "SERVICES" means projects conducted by JACKSON for other parties that may include but are not limited to the use of MICE or PRODUCTS. "RECIPIENT" means each recipient of MICE, PRODUCTS, or SERVICES provided by JACKSON including each institution, its employees and other researchers under its control. MICE or PRODUCTS shall not be: (i) used for any purpose other than internal research, (ii) sold or otherwise provided to any third party for any use, or (iii) provided to any agent or other third party to provide breeding or other services. Acceptance of MICE, PRODUCTS or SERVICES from JACKSON shall be deemed as agreement by RECIPIENT to these conditions, and departure from these conditions requires JACKSON’s prior written authorization.

No Warranty

MICE, PRODUCTS AND SERVICES ARE PROVIDED "AS IS". JACKSON EXTENDS NO WARRANTIES OF ANY KIND, EITHER EXPRESS, IMPLIED, OR STATUTORY, WITH RESPECT TO MICE, PRODUCTS OR SERVICES, INCLUDING ANY IMPLIED WARRANTY OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE, OR ANY WARRANTY OF NON-INFRINGEMENT OF ANY PATENT, TRADEMARK, OR OTHER INTELLECTUAL PROPERTY RIGHTS.

Credit for PRODUCTS or SERVICES

In case of dissatisfaction for a valid reason and claimed in writing by a purchaser within ninety (90) days of receipt of, PRODUCTS or SERVICES, JACKSON will, at its option, provide credit or replacement for the PRODUCT received or the SERVICES provided; JACKSON makes no other representations and this shall be the exclusive remedy of the purchaser. Please note specific policy for live mice.

Animal Care and Use for SERVICES

Consistent with the requirement for a written understanding regarding animal care and use, the JACKSON Animal Care and Use Committee will review the animal care and use protocol(s) associated with any SERVICES to be performed at JACKSON, and JACKSON shall have ultimate responsibility and authority for the care of animals while on site or in JACKSON custody.

No Liability

In no event shall JACKSON, its trustees, directors, officers, employees, and affiliates be liable for any causes of action or damages, including any direct, indirect, special, or consequential damages, arising out of the provision of MICE, PRODUCTS, or SERVICES, including economic damage or injury to property and lost profits, and including any damage arising from acts or negligence on the part of JACKSON, its agents or employees. Unless prohibited by law, in purchasing or receiving MICE, PRODUCTS, or SERVICES from JACKSON, purchaser or recipient, or any party claiming by or through them, expressly releases and discharges JACKSON from all such causes of action or damages, and further agrees to defend and indemnify JACKSON from any costs or damages arising out of any third party claims.

MICE, PRODUCTS or SERVICES are to be used in a safe manner and in accordance with all applicable governmental rules and regulations.

The foregoing represents the General Terms and Conditions applicable to JACKSON’s MICE, PRODUCTS or SERVICES. In addition, special terms and conditions of sale of certain MICE, PRODUCTS, or SERVICES may be set forth separately in JACKSON web pages, catalogs, price lists, contracts, and/or other documents, and these special terms and conditions shall also govern the sale of these MICE, PRODUCTS and SERVICES by JACKSON, and by its licensees and distributors.

Acceptance of delivery of MICE, PRODUCTS or SERVICES shall be deemed agreement to these terms and conditions. No purchase order or other document transmitted by purchaser or recipient that may modify the terms and conditions hereof, shall be in any way binding on JACKSON, and instead the terms and conditions set forth herein, including any special terms and conditions set forth separately, shall govern the sale of MICE, PRODUCTS or SERVICES by JACKSON.

Genetic overview

Research Applications

Base Price

Detailed Description

Development

Control Suggestions

Additional Information

Cnga3cpfl5

Allele Symbol: Cnga3cpfl5

Disease Terms

Model with phenotypic similarity to human disease where etiologies involve orthologs. Human genes are associated with this disease. Orthologs of those genes appear in the mouse genotype(s).

Research Areas By Phenotype

This mouse can be used to support research in many areas including:

Genotype: Cnga3cpfl5 related

Mammalian Phenotype Terms by Genotype

Genotype: Cnga3cpfl5/Cnga3cpfl5involves: RHJ/LeJ

nervous system phenotype

vision/eye phenotype

Genotype: Cnga3cpfl5/Cnga3cpfl5B6.RHJ-Cnga3/BocJ

nervous system phenotype

vision/eye phenotype

References

Additional - Cnga3cpfl5 related

Genotyping Protocols

Mating System

Citation

Animal Health Reports

Live Mouse

Cryorecovery - Pricing

Payment Terms and Conditions

The Jackson Laboratory's Genotype Promise

Terms Of Use

Licensing Information

JAX® Mice, Products & Services Conditions of Use

No Warranty

Credit for PRODUCTS or SERVICES

Animal Care and Use for SERVICES

No Liability

Cnga3^cpfl5

Allele Symbol: Cnga3^cpfl5

Genotype: Cnga3^cpfl5 related

Genotype: Cnga3^cpfl5/Cnga3^cpfl5
involves: RHJ/LeJ

Genotype: Cnga3^cpfl5/Cnga3^cpfl5
B6.RHJ-Cnga3/BocJ

Additional - Cnga3^cpfl5 related