B6.RHJ-Cnga3^cpfl5/BocJ

Stock number: 005978
Research areas: Sensorineural Research

Description

This spontaneous point transition, causing a substitution of alanine for threonine, provides a model for complete achromatopsis. Cone responses are lost but scotopic ERGs show sensitive rod responses.

Detailed description

Retinal staining of homozygotes with PNA at five months of age showed moderate cone loss in the cone outer segment, primarily in the ventral and nasal regions of the retina. Immunohistochemistry at three weeks of age showed normal M-opsin expression but diminished S-opsin expression, and by ten weeks of age no S-opsin staining and the M-opsin expression was mislocalized to the inner segment, cone nuclei and cone pedicles, consistent with early S-cone cell degeneration. By 5.5 months M-opsin was found in the superior retinal hemisphere but rarely found in the inferior hemisphere of homozygotes. Homozygotes were found to have decreased visual acuity and contrast sensitivity, as assessed at 5.5 months of age. At 5 weeks of age, no b-wave response was found in light-adapted ERG, and the b-wave amplitude in dark-adapted ERG was decreased, although statistically similar in amplitudes to that of C57BL/6J controls. Additionally, rod-mediated ERG responses were found to be lower than normal at 5.5 months of age. This homozygote provides a model for complete achromatopsis and AAV5-CBA-mCnga3-mediated gene replacement therapy initiated at 2 weeks of age has been shown to significantly improve these phenotypes (Pang et al., 2012). Because this mutation is an A to G substitution in exon 5 that generates a new SmaI site, PCR-RFLP can be used to genotype for this mutant allele. Primer pair CCTGGACTAGTCTGCAGATG and TGGACCAGTCAAGTCCGTGG will generate a PCR product that can be digested with SmaI to generate two bands, 53 and 37 bp, from mutant sequence and a single band, 90 bp, from wild-type sequence. Heterozygotes will generate all three bands. Protocol details can be obtained from Dr. Bo Chang.

Development

The mutation cone photoreceptor function loss 5 (cpfl5) arose spontaneously in the strain RHJ/LeJ-stpm/J and was identified in 2004. The cpfl5 mutation, an A to G substitution in exon 5 that generates a new SmaI site, was crossed onto C57BL/6J via backcross-intercross, reaching backcross generation N5 before the colony was maintained by sibling mating. In this process the stpm mutation was bred out of the line.

Allele

Symbol: Cnga3^cpfl5
Name: cone photoreceptor function loss 5
MGI accession ID: MGI:3608770
Generation method: Spontaneous
Marker symbol: Cnga3
Marker name: cyclic nucleotide gated channel alpha 3
Chromosome: 1
Strain of origin: Not Specified
Molecular note: Sequence analysis of this spontaneous phenotypic mutation identified a single A to G substitution at Chr1: 37,258,096 (GRCm38.p6, sequence ATGCTGGTTCGAGCCCGG(A-to-G)CA) which changes codon ACA to GCA in exon 5, changing amino acid 165 from threonine to alanine (p.T165A).