WLHR/LeJ

Stock number: 000147
Research areas: Cancer Research, Cardiovascular Research, Dermatology Research, Immunology, Inflammation and Autoimmunity Research, Metabolism Research, Neurobiology Research, Research Tools, Sensorineural Research

Description

This inbred mutant strain carries the wabbler-lethal (Atp8a2^wl) and hairless (Hr^hr) spontaneous mutations that are maintained in repulsion.

Detailed description

WLHR/Le is a balanced stock with wabbler-lethal (wl) and hairless (hr) spontaneous mutations maintained in repulsion on Chromosome 14. Homozygous wabbler-lethal mutant mice are first recognizable at 12 days of age and usually die at about four weeks. They have an abnormal wobbly gait and a pronounced tremor when walking. In an extensive study of behavioral development of this mutant, homozygous wabbler-lethal mice were shown to be deficient in nearly all behaviors tested. Histological examination showed myelin degeneration widely distributed throughout the CNS, particularly in the vestibulocerebellar and spinocerebellar systems. Electron microscopy showed widespread axonal (Wallerian) degeneration in the medulla with secondary myelin dissolution. Similar abnormalities were present to a lesser extent in the basal ganglia, spinal cord, and cerebellum and in the optic nerve. Homozygous hairless mutant mice have a higher incidence and earlier onset of leukemia, reducible by virus-specific antibody. A deficiency of splenic T helper cells (Ly1⁺) may account for low cellular immune response of homozygous mutant mice. The coat is normal on hairless mice up to 10 days but then hair is lost from the follicle. Waves of hair growth with few thin fuzzy hairs ocur at monthly intervals for some time but homozygotes eventually become continuously hairless. Vibrissae are repeatedly regrown and shed, becoming more abnormal with age. Toenails are long and curved. There is hyperkeratosis of statified epithelium and the upper part of hair canals beginning at 14 days. Hair club formation is abnormal. Cysts form from the hyperkeratotic upper part of hair canals and sheaths of abnormal follicles stranded in dermis. Some cysts also form from sebaceous glands. All cysts undergo sebaceous transformation and later keratinization.

Development

The first wabbler lethal (wl) mouse appeared in descendents of a non-inbred pirouette (pi/pi) mouse carrying brown (Typr1^b) and nonagouti (a) that was returned to the Jackson Laboratory from Dr. R. A. Fisher in 1948 after the fire. The pirouette male was mated to a C57BL/6J female and several lines were made. An outcross was also made to strain HD/Hu of Dr. Katrina Hummel. Strain HD/Hu was homozygous for hairless (Hr^hr) and dilute (Myo5a^d). The stock was bred using tested but non-sibling matings until 1958 when inbreeding was started as a balanced stock with wl and hr in repulsion phase because they were closely linked on chromosome 14. The stock was also selected to be homozygous brown and nonagouti. It was cryopreserved in 1989 by mating known doubly heterozygous males to either known heterozygous or untested females at generations F115-120.

Allele

Symbol: Atp8a2^wl
Name: wabbler lethal
MGI accession ID: MGI:1856271
Generation method: Spontaneous
Marker symbol: Atp8a2
Marker name: ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Chromosome: 14
Strain of origin: STOCK Grxcr1^pi
Molecular note: Spontaneous deletion of 21 bp (agccatcgaagaccgtcttca) in exon 22 results in elimination of seven highly conserved amino acids (AIEDRLQ) from the nucleotide-binding domain (N-domain).

Allele

Symbol: Hr^hr
Name: hairless
MGI accession ID: MGI:1856057
Generation method: Spontaneous
Marker symbol: Hr
Marker name: lysine demethylase and nuclear receptor corepressor
Chromosome: 14
Strain of origin: Not Specified
Molecular note: The hr allele is the result of a retroviral integration. Insertion of murine leukemia proviral sequences into intron 6 results in aberrant splicing of the gene.

Allele

MGI accession ID: MGI:95421
Marker symbol: Esd
Marker name: esterase D/formylglutathione hydrolase
Chromosome: 14