For in-depth product & services help, ask our
Technical Information Scientists
>chr1:71064897-71065094 198bp CTGCATATTAGTCCAGCAAAAGTC TTTGCTTGCGAGCCTCTT
Mutant = ~300 bp
Heterozygote = ~300 bp and 198 bp
Wild type = 198 bp
The reverse primer (primer 61376) anneals over the nucleotide sequence containing mouse genomic variation rs32908201
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 61375 | CTG CAT ATT AGT CCA GCA AAA GTC | Forward | A | |||
| 61376 | TTT GCT TGC GAG CCT CTT | Reverse | A |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 61375 | 0.50 uM |
| 61376 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.