Stock No: 039797
Protocol 31996: Probe Assay - Edil3<Tg(Sox2-cre)1Amc>-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  102 bp

Wild Type = 100 bp


>chr13:89451280+89451379 100bp TCCCACTATATTGGCTGTAGATTC TCCAGTAAGCCAATGAAACAC

Expected Results note (public):
This assay may be capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr #.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.
(Also add this if it’s a probe assay) This protocol can be used for conventional PCR.  Omit probes and run as a separated assay.

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
38141 TCC CAC TAT ATT GGC TGT AGA TTC Wild type Forward A
38142 TCC AGT AAG CCA ATG AAA CAC Common A
38143 Fluorophore-1 TTG AAA GAA TGC ACT CAT ACT TAG ACT AAT Quencher-1 WT Probe
38144 TTC CTT CGG CCT GCT CTT AG Mutant Forward A Sox2
38145 Fluorophore-2 CCG AGG CTT ATC ACT CAT ACT TAG ACT A Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
38141 0.40 uM
38142 0.40 uM
38144 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
039797 B6(CBA)-Chd8em3.1Lutzy/Mmjax
008454 B6.Cg-Edil3Tg(Sox2-cre)1Amc/J
034605 B6J(CBA)-Kcnn3em1.1Lutzy/Mmjax
032664 C57BL/6J-Grin2bem5Lutzy/J
4 strains use this protocol