Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 102 bp
Wild Type = 100 bp
>chr13:89451280+89451379 100bp TCCCACTATATTGGCTGTAGATTC TCCAGTAAGCCAATGAAACAC
Expected Results note (public):
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr #.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
(Also add this if it’s a probe assay) This protocol can be used for conventional PCR. Omit probes and run as a separated assay.
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38141 | TCC CAC TAT ATT GGC TGT AGA TTC | Wild type Forward | A | |||
| 38142 | TCC AGT AAG CCA ATG AAA CAC | Common | A | |||
| 38143 | Fluorophore-1 | TTG AAA GAA TGC ACT CAT ACT TAG ACT AAT | Quencher-1 | WT Probe | ||
| 38144 | TTC CTT CGG CCT GCT CTT AG | Mutant Forward | A | Sox2 | ||
| 38145 | Fluorophore-2 | CCG AGG CTT ATC ACT CAT ACT TAG ACT A | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38141 | 0.40 uM |
| 38142 | 0.40 uM |
| 38144 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.