Protocol 21989: End Point Analysis Assay - Kit<W-41J>-EP

B6.Cg-Ptprc^a Pepc^b Kit^W-41J Gpi1^a/IslabMmjax

Stock No: 039112

Version 2.0

Notes

Mut = A

WT= G

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

GAGGTCACAAGGTTTAAGGTCCTCGTCTATCGCTGTCTTCATTAGCTGCTTGAATTTGC
TGTGTTCCGTTCTAGGCACGACTGCCC(g/a)TGAAGTGGATGGCACCAGAGAGCATTTT
CAGCTGCGTGTACACATTTGAAAGTGATGTCTGGTCCTATGGGATTTTCCTCTGGGAG

JAX Protocol

Protocol Primers

Primer	5' Label	Sequence 5' → 3'	3' Label	Primer Type	Reaction	Note
24704		AGG TCC TCG TCT ATC GCT GT		Forward	A
24705		AAA TGC TCT CTG GTG CCA TC		Reverse	A
24706	Fluorophore-1	ACT GCC CGT GAA GTG GAT	Quencher-1	WT Probe
24707	Fluorophore-2	ACT GCC CAT GAA GTG GAT G	Quencher-2	MUT Probe

Reaction A

Component	Final Concentration
Kapa Probe Fast QPCR	1.00 X
ddH2O
24704	0.40 uM
24705	0.40 uM
Wt Probe	0.15 uM
Mutant Probe	0.15 uM
DNA

Cycling

Step	Temp °C	Time	Note
1	95.0	--
2	95.0	--
3	60.0	--
4		--	repeat steps 2-3 for 40 cycles
5	40.0	--	Forever

JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number	Strain Name
039112	B6.Cg-Ptprc^a Pepc^b Kit^W-41J Gpi1^a/IslabMmjax
000119	C57BL/6J-Kit^W-41J/J
026622	NOD.Cg-Kit^W-41J Tyr ^+ Prkdc^scid Il2rg^tm1Wjl/ThomJ
026497	NOD.Cg-Kit^W-41J Prkdc^scid Il2rg^tm1Wjl/WaskJ
026014	NOD.Cg-Rag1^tm1Mom Kit^W-41J Il2rg^tm1Wjl/EavJ
5 strains use this protocol