Genotyping Protocols Database
Stock No: 003648
Protocol 33741: Probe Assay - Clcc1<m1J> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr3:108661495+108661647 153bp GGTATTTGGGTCTGGGGTCTT GCATGACAGCTAATCCATCG

Mutant=  140 bp

Wild Type = 153 bp

Sequence

Wt Sequence:

 

Mutant Sequence:

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
42099 GGT ATT TGG GTC TGG GGT CTT Common A
42100 GCA TGA CAG CTA ATC CAT CG Wild type Reverse A
42101 CAA CTT AGA ACA CAG GAT GTC AGC Mutant Reverse A
42102 Fluorophore-1 TTC GCC GTC ACA AGA TGG Quencher-1 MUT Probe
42103 Fluorophore-2 TGC AGA GCT GTG AGA GTC ACA Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
42099 0.40 uM
42100 0.40 uM
42101 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
000474 C3H/HeSn
000661 C3H/HeSnJ
003648 C3Sn.BLiA-Pde6b+/DnJ
3 strains use this protocol