For in-depth product & services help, ask our
Technical Information Scientists
Notes
Mut = C (C57BL/10SnJ)
WT= T (NOD/ShiLtJ)
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
SEQ:
GAGTGCTTCCTGGATGCACAAAGCCCAGGATTCAA(t/c)CTCCAGCACCTCGAA(t/-)A(a/t)AAAAGGAGATATAATTCTTCTACC
Nucleotide change in bold and red is the mutation of interest. Other bp differences between NOD/ShiLtJ and C57BL/10SnJ are also noted
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 61124 | GAG CAA AAG AAC CAC AAC TGC | Forward | A | |||
| 61125 | ACA TAG GGC TGG CAT AAC AGT | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 61124 | 0.50 uM |
| 61125 | 0.50 uM |
| Glycerol | 6.50 % |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.