For in-depth product & services help, ask our
Technical Information Scientists
Notes
wrong Common: correct is oIMR1621: see REQ 434021 SAC 10-31-17
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = ~150 bp
Heterozygote = ~150 bp and 289 bp
Wild type = 289 bp
Heterozygote = ~150 bp and 289 bp
Wild type = 289 bp
Sequence
chr3:146612294+146612566 273bp CGAGACCTTTGCAATGAACA CTCATCTGCTCCACCTCACA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| oIMR1621 | CGA GAC CTT TGC AAT GAA CA | Common | A | |||
| oIMR1622 | CTC ATC TGC TCC ACC TCA CA | Wild type Forward | A | |||
| oIMR6218 | CCT TCT ATC GCC TTC TTG ACG | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| oIMR1621 | 0.50 uM |
| oIMR1622 | 0.50 uM |
| oIMR6218 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.