B6 x B6JCu.Cg-Atp8a2^wl/J

Stock number: 004835
Product name: wabbler lethal
Research areas: Neurobiology Research, Sensorineural Research

Description

The spontaneous, autosomal recessive mutation wl (wabble-lethal) is a deletion in Atp8a2 (ATPase, aminophospholipid transporter-like, class I, type 8A, member 2). Homozygous mice exhibit progressive ataxia and axonopathy. This strain may be useful in studies of axonal degeneration.

Detailed description

Wabbler-lethal (wl) is spontaneous, recessive mutation discovered in 1952 at The Jackson Laboratory. Mice homozygous for the mutation can be identified at 12 days of age by an abnormal wobbly gait, small body size, a hind limb clasping reflex, and a pronounced tremor when walking. Twenty percent of mice die by 65 days, and 100% by 130 days. In 2012, the mutation was determined to be a 21 bp deletion in exon 22 of the Atp8a2 (ATPase, aminophospholipid transporter-like, class I, type 8A, member 2) gene. Atp8a2 encodes a member of the P4 ATPase family of proteins and has phosphatidylserine translocase (flippase) activity. ATP8A2 is involved in lipid flipping, specifically, the localization of phosphatidylserine to the inner leaflet of the plasma membrane. Homozygous wl mice develop a progressive, distal axonopathy resulting in degeneration of the central and peripheral nervous system. The axonopathy is characterized by chromatolysis in the lateral and medial cerebellar nucleus, lateral vestibular nucleus, and spinal ventral horn. Cell loss is not observed. Dystrophic axons are present in the corticospinal tract, spinalcerebellar tract, retinal ganglion cells, and spinal white matter. Distal axonal degeneration is observed in the femoral and sciatic nerves. This strain may be useful in studies of axonal degeneration.

Development

The wabbler-lethal spontaneous mutation arose on the STOCK Grxcr1^pi colony in 1952 at The Jackson Laboratory. Mice were phenotypically identified by ataxia and body tremors beginning at 12 days of age. The mutation was determined to be a 21 base pair deletion (agccatcgaagaccgtcttca) in exon 22 of the Atp8a2 gene on chromosome 14. The deletion removes seven highly conserved amino acids (AIEDRLQ) from the nucleotide-binding domain (N-domain). The strain was backcrossed to C57BL/6JCu for approximately 35 generations. The strain was cryopreserved in 2004 by sperm cryopreservation and will be recovered by a cross to C57BL/6J females.

Allele

Symbol: Atp8a2^wl
Name: wabbler lethal
MGI accession ID: MGI:1856271
Generation method: Spontaneous
Synonyms: Wl
Marker symbol: Atp8a2
Marker name: ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Marker synonyms: agil; ATP; ATPIB; CAMRQ4; IB; ML-1; wl
Chromosome: 14
Strain of origin: STOCK Grxcr1^pi
Molecular note: Spontaneous deletion of 21 bp (agccatcgaagaccgtcttca) in exon 22 results in elimination of seven highly conserved amino acids (AIEDRLQ) from the nucleotide-binding domain (N-domain).