Mut = AGA (R194)
WT= CAC (H194)
SEQ (bp changes in brackets with wt first):
cttacttctgtgctttgaccccagGTC(C/T)T(G/A)(CAC/AGA)TGCACCGGGCAAGTGAGAGTCTACAACAAC
Nucleotide changes in bold and red are mutations of interest. Other bp changes (plus or minus X) are silent mutations.
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79893 | GCA CGG TCA CCA ACA GAG | Forward | A | Epas1/exon5 | ||
| 79894 | CTC AGG AAA GTC TTG CTG TCC | Reverse | A | Epas1/exon6 |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 79893 | 0.50 uM |
| 79894 | 0.50 uM |
| Glycerol | 6.50 % |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.