For in-depth product & services help, ask our
Technical Information Scientists
human Mut = G
human WT= C
This is an absence presence assays to detect the point mutation and will not distinguish hemi from hom
SEQ
AAGGCCAAGCCCCCGGCCGACCCAGCGGCGGCCGCGTCGCCGT(g/c)TCGTGCGGCCGCCGGCGGCCAGGGCTCGGCGGTGGCTGCCGAA
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79877 | GGA GCC CAG GAA GGC AGC | Forward | A | EGLN1/exon1 | ||
| 79878 | CCT GGA ACA GCG ATG AGC GG | Reverse | A | EGLN1/exon1 |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 79877 | 0.50 uM |
| 79878 | 0.50 uM |
| Glycerol | 6.50 % |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.