For in-depth product & services help, ask our
Technical Information Scientists
Notes
Mut = T
WT= C
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
SEQ (bp changes in brackets with wt first):
TGTTTAGATCTCTAAATTACATAAACTTTTATTTACCTTCTTCTTGATATGAATGAAACT
CATCAAATATGCGTGTTAGTGTAAATGAACTTCTATTTAATTTTGAGGCTCTGCAAAGT
TCTTTGAAAGAGCAA(c/t)AAAATGGCTTCAACTATCTGAGTGACACTGTGAAGGAGA
TGGCCAAGAAAGCACCTTCAGAAATATGCCAGAAATATCTGTCAGAATTTGAAGAGA
TTGAGGGGCACTGGAAGAAACTTTCCTCCCAGTTGGTGGAAAGCTGCCAAAAGCTA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73509 | ACC TTC TTC TTG ATA TGA ATG A | Forward | A | |||
| 76455 | AAA CCT CGG CTT ACC TGA AA | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73509 | 0.40 uM |
| 76455 | 0.40 uM |
| Primer 3 | 0.40 uM |
| Primer 4 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 017929 | B10.Cg-Cmahtm1Avrk Dmdmdx/PtmJ |
| 027818 | B10.Cg-Dmdmdx Tg(ACTA1-DMD*)326Dua/Mmjax |
| 027820 | B10.Cg-Dmdmdx Tg(Myh6-DMD*)#Dua/Mmjax |
| 027819 | B10.Cg-Dmdmdx Tg(Myh6-DMD*)47Dua/Mmjax |
| 018018 | B10ScSn.Cg-Prkdcscid Dmdmdx/J |
| 019014 | B10ScSn.Cg-Utrntm1Ked Dmdmdx/J |
| 027821 | B6.B10-Dmdmdx/Mmjax |
| 027822 | C.B10-Dmdmdx/Mmjax |
| 001801 | C57BL/10ScSn-Dmdmdx/J |
| 013141 | D2.B10-Dmdmdx/J |
| 022506 | D2.Cg-Utrntm1Ked Dmdmdx/J |
| 038371 | D2.Cg-Tg(DMD*)#Spc Dmdmdx/J |
| 027823 | FVB.Cg-Dmdmdx Tg(Myh6-DMD*)271Dua/Mmjax |
| 018915 | STOCK Terctm1Rdp Dmdmdx/J |
| 016622 | STOCK Utrntm1Jrs Dmdmdx/J |
| 014563 | STOCK Utrntm1Ked Dmdmdx/J |
| 013158 | STOCK Utrntm1Ked/J |
| 17 strains use this protocol | |