D2.Cg-Tg(DMD*)#Spc Dmd^mdx/J

Stock number: 038371
Product name: hDMD(del45) mdxD2
Strain synonyms: hDMD(del45) mdxD2
Research areas: Cell Biology Research, Mouse/Human Gene Homologs, Neurobiology Research, Sensorineural Research

Description

The hDMD(del45) mdxD2 strain harbors both a mutant human DMD (dystrophin, muscular dystrophy) transgene, del45, and mouse Dmd knock-out allele. These mice may be useful for studying Duchenne and Becker muscular dystrophies.

Our preclinical efficacy testing services offer scientific expertise and an array of target-based and phenotype-based outcome measures, both in vivo and at endpoint, for flexible study designs and assay development in mouse models of Muscular Dystrophy. See our full service platform.

Detailed description

Duchenne muscular dystrophy (DMD) is a progressive muscular disorder caused by an imbalance between muscle degeneration and regeneration resulting in muscle degeneration, necrosis, accumulation of fat and fibrosis, and insufficient regeneration/loss of myofibers. Mutations of the dystrophin muscular dystrophy gene (Dmd), on the X chromosome, may result in early-onset dystrophy (DMD), late-onset Becker muscular dystrophy (BMD) or DMD-associated dilated cardiomyopathy. Exons 44-55 of the Dmd gene are considered hotspots for deletions in muscular dystrophy cases, with exon 45 deletions being the most common in human DMD patients.

The hDMD(del45) mdxD2 double mutant mice express a mutant human DMD transgene, with an exon 45 deletion, and the mouse Dmd knock-out allele. The donating investigator purchased hDMD transgenic mice (Stock No. 018900), which expresses full length wildtype human DMD cDNA, and using CRISPR/Cas9-editing technology created a human exon 45 deletion (del45) hDMD transgene. The CRISPR-generated hDMD(del45) transgene results in expression of an out-of-frame DMD transcript and lack of functional dystrophin. The hDMD(del45) transgenic mice were crossed to D2-mdx mutants (Stock No. 013141) to generate this hDMD(del45) mdxD2 double mutant strain on a DBA/2 background.

Female mice that are hemizygous for the hDMD(del45) transgene and homozygous for the D2-mdx allele and males that are hemizygous for the hDMD(del45) transgene and hemizygous for the D2-mdx allele are viable and fertile. The donating laboratory has generated mice that are homozygous for the hDMD(del45) transgene, but these homozygous hDMD(del45) transgenic mice have not been characterized to date (July 2023). Mice that are hemizygous for the hDMD(del45) transgene and homozygous/hemizygous for the D2-mdx allele demonstrate expected dystrophic phenotype, similar to D2-mdx mutants (Stock No. 013141), including features of fibrosis, inflammation, and calcium deposits. This strain may be useful for studying potential gene-therapies targeting the human sequence/exon skipping for muscular dystrophies.

Development

These hDMD(del45) mdxD2 double mutant mice were generated by CRISPR/Cas9-modification of the full length human DMD transgene (Stock No. 018900), resulting in deletion of DMD exon 45 (del45). These hDMD(del45) transgenic mice were then crossed to the D2-mdx strain (Stock No. 013141) resulting in this hDMD(del45) mdxD2 double mutant strain.

The hDMD transgenic mice were originally created by Dr. Peter A. C. 't Hoen (Leiden University Medical Center). The original full length hDMD transgene was developed as follows: First, a 2.7 Mbp yeast artificial chromosome (YAC) sequence containing the full-length 2.3 Mbp human dystrophin gene (DMD) was obtained. The YAC also contained a hygromycin resistance cassette on one end and a neomycin resistance cassette on the other. Spheroplast fusion of YAC-containing yeast cells with murine (DBA2 x 129OLA)F1-derived embryonic stem (ES) cells resulted in ES cells with transgene integration on mouse chromosome 5 (see updated note on transgene integration and copy number below). Some of the full-length human DMD (hDMD) transgenic mice were purchased by Dr. Melissa Spencer (UCLA); Dr. Spencer's laboratory modified the transgene by targeting exon 45, using CRISPR/Cas9-editing. Guide RNAs, ssDNA, and the Cas9 nuclease mRNA were introduced into the cytoplasm of hDMD transgenic (Stock No. 018900) zygotes with well recognized pronuclei. Correctly targeted pups were identified by PCR and then crossed to D2-mdx mice (Stock No. 013141) for at least 5 generations by the donating laboratory.

The spontaneous mutation "X chromosome-linked muscular dystrophy" (mdx) has as a C-to-T transition resulting in a termination codon at position 2983 (ENSMUST00000114000 chrX:g.83803333 C>T; p.Q995*) within exon 23 of the dystrophin muscular dystrophy gene (Dmd) on the X chromosome [note that Sicinski et al., 1989 originally reported termination codon at position 3185]. C57BL/10ScSn-Dmd^mdx (C57BL/10-mdx) mice are available from The Jackson Laboratory as Stock No. 001801. In 2010, some C57BL/10-mdx mice were backcrossed to DBA/2J inbred mice (Stock No. 000671) for several generations using a marker-assisted, speed congenic approach to generate the D2.B10-congenic strain (also referred to as D2-mdx) as Stock No. 013141.

Upon arrival at The Jackson Laboratory, the hDMD(del45) mdxD2 sperm, hemizygous for the hDMD(del45) transgene and hemizygous for the D2-mdx allele, was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize D2-mdx oocytes (Stock No. 013141).

Guide RNAs and donor sequences used for generation of the hDMD(del45) transgenic construct are detailed below and also described in Young et al., J Neuromuscul Dis, 2017. Note that bolded nucleotides indicate protospacer adjacent motif (PAM).
44C1: Sequence, ATATACTTGTGGCTAGTTAGTGG and Guide RNAs, CACCGATATACTTGTGGCTAGTTAG and AAACCTAACTAGCCACAAGTATATC.
44C2: Sequence, ATTCACCTTGAAGCAATCATGGG and Guide RNAs, CACCGATTCACCTTGAAGCAATCAT and AAACATGATTGCTTCAAGGTGAATC.
45C2: Sequence, TGTCCTACAAATCAATTAGTTGG and Guide RNAs, CACCGTGTCCTACAAATCAATTAGT and AAACACTAATTGATTTGTAGGACAC.
45C3: Sequence, CAGGGAAAAAAGCACCCTCTCGG and Guide RNAs, CACCGCAGGGAAAAAAGCACCCTCT and AAACAGAGGGTGCTTTTTTCCCTGC.

Note on hDMD transgene integration and copy number: Whereas the original publication used COBRA-FISH analysis to identify a single copy integration of the hDMD transgene into mouse chromosome 5 [t Hoen et al. 2008 J Biol Chem. 283:5899 (PMID:18083704)], the same institution later used additional technologies (FISH, sequencing and ddPCR analyses) to determine the hDMD transgene insertion on chromosome 5 to be a tail-to-tail duplication [Yavas et al. 2020 PLoS One. 15:e0244215 (PMID:33362201)].

Allele

Symbol: Dmd^mdx
Name: X linked muscular dystrophy
MGI accession ID: MGI:1856328
Generation method: Spontaneous
Synonyms: mdx; pke; pyruvate kinase expression
Marker symbol: Dmd
Marker name: dystrophin, muscular dystrophy
Marker synonyms: BMD; CMD3B; DNADMD1; Dp427; Dp71; Duchenne muscular dystrophy; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272; dys; mdx; MRX85; pke; X-linked muscular dystrophy
Chromosome: X
Strain of origin: C57BL/10ScSn
Molecular note: This mutation arose in 1981 in a C57BL/10ScSn colony at University of Leicester. A C-to-T substitution in the CAA codon in exon 23 (ENSMUST00000114000 chrX:g.83803333C>T; c.2983C>T; p.Q995*) results in a termination codon (TAA) in place of a glutamine codon. This allele is predicted to produce a truncated protein.

Allele

Symbol: Tg(DMD*)#Spc
Name: transgene insertion, Melissa J Spencer
MGI accession ID: MGI:6507847
Generation method: Endonuclease-mediated
Attributes: Inserted expressed sequence; Humanized sequence
Synonyms: hDMD del45
Marker symbol: Tg(DMD*)#Spc
Marker name: transgene insertion, Melissa J Spencer
Marker synonyms: hDMD del45
Chromosome: 5
Strain of origin: STOCK Tg(DMD)72Thoen/J
Molecular note: CRISPR/Cas9 technology generated a deletion of exon 45 of the human DMD in Tg(DMD)72Thoen mice. Two founders were used to establish lines, however the pound symbol (#) is used when line is not specified and/or lines are pooled. The transgene integrated on chromosome 5 in a tail to tail duplication.