For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 106 bp
Wild Type = 117 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase:
accgtgtcgctgtgccacatcctagcgctgtgcgcggggctgccgccgctgctgcgcgcctggcgcgtgccgcccgcgccacccgtgtcgggccccggacccggcccgcatccggcgtccggcccgctgctgccgccgcgcttctatccgcgttacgtactgccgcttgcctttggcaagtacttcgcgtcggtgtcggcgcacgtcagcatctggaaggtgccggtctcctacgcgcacaccggtaagtgctgaggcgggctttgcgcgctgtctggggcttcgaagtgtgggtacgagtgcgcgggccgtctgactgagacgccgccaaggtgcgtcggattctcacgttggaaaaggtctgaggagtttaccgagcgcctagcagaattgactccagctattgggaTCccagggcggtggcttcaagcagactggccagagcagcccttcctatgcttactgtctgcctgagtcactatcccttgttttattttgaaaactaaccctaaacctaacctaccctgctatctcttgttccttttctttaataagttttcttgctacattttatttatattcgtgctctgtgtgcaagggcacttgcctcacggtggtggtcagagggcaacttaaaggaataatgtgggaccttaactga
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCCTGGTGCAAGTCGCCCCA and CTCCAGCTATTGGGATCGAG. This resulted in a 2,579 bp deletion of chr8:72,489,421-72,491,999(GRCm38/mm10) that removes exons ENSMUSE00001078079 and ENSMUSE00000507329.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 75727 | GCA GAA TTG ACT CCA GCT AT | Common | A | |||
| 75728 | TTG ACT GCA AGA GAG GAA A | Wild type Reverse | A | |||
| 75729 | AAC AAG GGA TAG TGA CTC AG | Mutant Reverse | A | |||
| 75730 | Fluorophore-1 | TAC AGA AGG AAG GTT CAG GG | Quencher-1 | WT Probe | ||
| 75731 | Fluorophore-2 | CAG AGC AGC CCT TCC TAT GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 75727 | 0.50 uM |
| 75728 | 0.50 uM |
| 75729 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.