For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 130 bp
Wild Type = 139 bp
chr4:148592936+148593074 139bp AAGACACCATAACACAGCAT TCAAACTCTTGATCGTCCTG
Sequence
Large deletion: Mutant sequence with junction in uppercase
gcccgcagtaaaacctacggcaacgtgctggttctggatggcgtcatccagtgtactgagagggatgagttctcctaccaggagatgatcgccaacctgccgctctgcagccaccccaacccgcggaaggtaccgcattgcccctgggttcagccctgagctcggggtcctagaaaagcatgtcgggctgacactaggtgaggatgtttgggggcagatgctacccagatgactgtcagaaaatgcgggtcggtcaggatgaatagagctcctgggagagctggtctccttagaagccccgagaggggaacccaggctgccaggaaggaccccgtGAacatgggtccagcacctgctttgccactgagctgctgtgggtgactgtggcctggaggtctcaggcaggatggccatgctctacccctctaggccctgctgagagcctcttcaaggagtcctattaccagctcatgaagacagcactcaaagaagatggcatcctgtgctgccagggtgagtgccagtggctgcacctggacctcatcaaggagatgagg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CAGAACGCTTCTGTGCCACG and GGTGCTGGACCCATGTTTGT. This resulted in a 1,303 bp deletion of Chr4:148,592,372-148,593,674 (GRCm38/mm10) that removes exons ENSMUSE00001226189 and ENSMUSE00001218352.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 74691 | AAG ACA CCA TAA CAC AGC AT | Wild type Forward | A | |||
| 74692 | TCA AAC TCT TGA TCG TCC TG | Wild type Reverse | A | |||
| 74693 | GCT GGT CTC CTT AGA AGC | Mutant Forward | A | |||
| 74694 | CAT CCT GCC TGA GAC CTC | Mutant Reverse | A | |||
| 74695 | Fluorophore-1 | AGA TAT GGA GAA CAC AGG CT | Quencher-1 | WT Probe | ||
| 74696 | Fluorophore-2 | CTT TGC CAC TGA GCT GCT GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 74691 | 0.40 uM |
| 74692 | 0.40 uM |
| 74693 | 0.40 uM |
| 74694 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.