C57BL/6NJ-Srm^em1(IMPC)J/MmJax

Stock number: 039787

Allele

Symbol: Srm^em1(IMPC)J
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:7666159
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Srm
Marker name: spermidine synthase
Marker synonyms: PAPT; SpdST; SpdSy; SPS1; SRML1
Chromosome: 4
Strain of origin: C57BL/6NJ
Molecular note: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CAGAACGCTTCTGTGCCACG and GGTGCTGGACCCATGTTTGT. This resulted in a 1,303 bp deletion of Chr4:148,592,372-148,593,674 (GRCm38/mm10) that removes exons ENSMUSE00001226189 and ENSMUSE00001218352.