For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:87862393+87862528 136bp GGATTCTAAGCTCCTTGGC TCCCGCGTTAGTCTCGTGTA
Mutant= 109 bp
Wild Type = 136 bp
Sequence
Wt Sequence:
ggatattagcccaaaacctaggatAcccaagatCcttactgcattcttacaggattcTaagctccttggcttctgggaccttggaACattggggagacttaactatatcagaatttaatcTTaaaaggcaTttataataaaatactaaaagagagctcgtagttccatacacgagactaacgcgggaatagggtatgagtatatgggtaaatgagaacaccaaa
Mutant Sequence:
GCCTGGAAGACCTGGGACTCCTGCCCATATGTCCTAAGCTCCCCACCCACCCACTCGTTCACTGTCCTTATTCTCTCTCTACCTTCAGCCACTTAGTTTCCTACCTTAAGTCCTAGAATTgatcctggcgtaatagcgaagaggcCcgcaccgataaAAGGCATTTATAATAAAATACTAAAAGAGAGCTCGTAGTTCCATACACGAGACTAACGcgggaatag
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44089 | TCC CGC GTT AGT CTC GTG TA | Common | A | |||
| 44091 | CCT AGA ATT GAT CCT GGC GTA | Mutant Forward | A | |||
| 45529 | Fluorophore-1 | ATA GCG AAG AGG CCC GCA C | Quencher-1 | MUT Probe | ||
| 69186 | GGA TTC TAA GCT CCT TGG C | Wild type Forward | A | |||
| 70096 | Fluorophore-2 | CTG GGA CCT TGG AAC ATT G | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44089 | 0.40 uM |
| 44091 | 0.40 uM |
| 69186 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.