For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 73 bp
Wild Type = 85 bp
>chr10:76770283-76770367 85bp CTCTCCTTGAGGGCAAAACA TGAGCTTCTTCGGAGGAGTG
Sequence
Large deletion: Mutant sequence with junction in uppercase
tgctgcagcccctcctaggatagcactgacagagctagcctgcactcaggccagtggtgaagcagacagaggggctggctacagcctggccgggcatctgcctcagatgtccctcactgaagcagagcCGctggacccactgttgcatcttttgcctcctttcttttccaccttcaactgataccattcccatgaaagatgcagacaagaaagaagtggaacatcagggtgaatcagaagtcagcatcagagctgggccgg
This mutation is a 2657 bp deletion beginning at Chromosome 10 position 76,767,806 bp and ending after 76,770,462 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67812 | CTC TCC TTG AGG GCA AAA CA | Wild type Forward | A | |||
| 67813 | TGA GCT TCT TCG GAG GAG TG | Wild type Reverse | A | |||
| 67814 | TCT GCC TCA GAT GTC CCT CA | Mutant Forward | A | |||
| 67815 | GGA AAA GAA AGG AGG CAA AAG | Mutant Reverse | A | |||
| 67816 | Fluorophore-1 | CCT CTC TCT TCT TTG CTC TCC A | Quencher-1 | WT Probe | ||
| 67817 | Fluorophore-2 | CTG AAG CAG AGC CGC TGG AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67812 | 0.40 uM |
| 67813 | 0.40 uM |
| 67814 | 0.40 uM |
| 67815 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.