For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 129 bp
Wild Type = 127 bp
>chr11:107734729-107734855 127bp GCATGACTTCTTCCAACAGG TCACACAAACAGCCACCTTG |
Sequence
Wt Sequence (deletions in lower case):
TTCTTCCTGTTGTGAGTCTAACCTCCATCTCTCTCCCTGCCCCGCTTTCTTTCAGGCCTCAgtaatatcatcggtatcatcgtctacatttccagcaacacgggcgaccccagtgacaaacgtgacgaagacaaaaagaaccattacaactacggctggtctttttactttggagccctgtcgtttattgtggcggagaccgtgggcgtcctggctgtaaacatttacattgagaaaaataaagagttgaggtttaagaccaagcgggagttccttaaggcctcttcctcctctccttacgccaggatgccgagctacaggtaccggcgacggcggtccaggtccagttcaaggtccacggaggcctcaccctccagggatgcatctcccgtgggcctgaagatcaccggagccattcccatgggtgagctgtccatgtacacgctatccagagaaccccttaaggtgaccacagctgcgagctacagtccggaccaggacgctggcttcctgcagatgcatgacttcttccaacaggacctaaaggaaggtttccatgtcagcatgctgaaccggcGGACGACTCCCGTGTGACCCGCCCACCCCTCTCGGCACAGGCCTCCCCCAAGGTGGCTGTTTGTGTGA
This mutation is a 516 bp deletion beginning at Chromosome 11 position 107,734,797 bp and ending after 107,735,312 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64895 | GCA TGA CTT CTT CCA ACA GG | Wild type Forward | A | |||
| 64896 | TCA CAC AAA CAG CCA CCT TG | Common | A | |||
| 64898 | Fluorophore-1 | TTC CAT GTC AGC ATG CTG A | Quencher-1 | WT Probe | ||
| 66312 | TTC TTC CTG TTG TGA GTC TAA CC | Mutant Forward | A | |||
| 66313 | Fluorophore-2 | TCA GGC CTC AGG ACG ACT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 64895 | 0.50 uM |
| 64896 | 0.50 uM |
| 66312 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.