For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 110 bp
Wild Type = 95 bp
>chr5:118738151+118738245 95bp ATGCCATACAGCCCTTGAGA GCAGTGTCCACACAAGGCTA
The WT Probe (#65746) anneals over the nucleotide sequence containing mouse genomic variation rs212539772.
Sequence
Wt Sequence:
CTGCTCACTGCATTAGCATTACACCATGCCATACAGCCCTTGAGAGGGGGAGGCTCGGGAGTGTGGCCGcctgagggtgacctgtgtcttgacattctgttagccttgtgtggacactgctgtgcctggctgcttgtctcagctttgaggaatcttgctgttaagatgcacttttaattttgtttttagcagttgcagacttgcaaaggatgttccccacccctccgtcattggaacagcaccctgcattttctcctgtgatgaactataaagatggagtaagttcagagacagtgactgcactgggcatgatggagagtcccgtggtcagcatggtccccacacacctcacggagtttaggatggaagtggaagatggcttaggaagccccaagccagaggagataAAGGTAATAACCAGTTTGGGCTTCCCCAGGGCTGGGGTGCTTTTCAGTGGGCCACACACACGAGTGCATAAGGACCATTGAAACTGGAGCTTGTCAGTAGAAGTCACTCCATCA
Mutant Sequence:
TCTGCAGACTCTGCTCACTGCATTAGCATTACACCATGCCATACAGCCCTTGAGAGGGGGAGGCTCGGGAGTGTGGCCGgcgcctggctataagctaggactttttagaagcccttcctattaaacaaattttttttatttcttatttttagcagttgcagacttgcaaaggatgtttc(t)cactccaccatctttggaacagcatcctgcattttctcctgtgatgaattataaagatgggatcagctcagagacagtgacagcattaggcatgatggagagccctatggtcagtatggtttcaacacaactcacagaattcaaaatggaagtggaagatggattaggaagtcccaagcccgaggaaattAAGGTAATAACCAGTTTGGGCTTCCCCAGGGCTGGGGTGCTTTTCAGTGGGCCACACACACGAGTGCATAAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65743 | ATG CCA TAC AGC CCT TGA GA | Wild type Forward | A | |||
| 65744 | GCA GTG TCC ACA CAA GGC TA | Wild type Reverse | A | |||
| 65746 | Fluorophore-1 | AGG GTG ACC TGT GTC TTG ACA TTC | Quencher-1 | WT Probe | ||
| 65748 | TTT AGA AGC CCT TCC TAT TAA ACA | Mutant Forward | A | |||
| 65749 | AAT GCA GGA TGC TGT TCC A | Mutant Reverse | A | |||
| 66212 | Fluorophore-2 | AAG GAT GTT TCT CAC TCC ACC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65743 | 0.40 uM |
| 65744 | 0.40 uM |
| 65748 | 0.40 uM |
| 65749 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.