For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 146 bp
Wt = 139 bp
Fam = Mut
Hex = Wt
>chr15:25991365+25991503 139bp CCTTTTAAGGGTTATTCGGTCA ACTAAACGGGAGACCTGCAT
Sequence
MUT Sequence (junction in uppercase):
ccttttaagggttattcggtcacatttgttggcagaaaaattctgacagtaatttttatcactcagttcttgtagtggGCaagactccatgacttaaaaaattaatattcctggtctagtaacttagtatgcatcatgaacctttccagaagata
This mutation is a 5037 bp deletion beginning at Chromosome 15 position 25,991,444 bp and ending after 25,996,480 bp (GRCm39/mm39).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 56699 | GGA AAG GTT CAT GAT GCA TAC TAA G | Mutant Reverse | A | |||
| 59620 | CCT TTT AAG GGT TAT TCG GTC A | Common | A | |||
| 59621 | ACT AAA CGG GAG ACC TGC AT | Wild type Reverse | A | |||
| 59623 | Fluorophore-1 | ATT TGG TAG CTT GGC CAC ATT T | Quencher-1 | WT Probe | ||
| 59814 | Fluorophore-2 | AGT GGG CAA GAC TCC ATG ACT TAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 56699 | 0.40 uM |
| 59620 | 0.40 uM |
| 59621 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.