For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 79 bp
Wild Type = 83 bp
>chr10:75326318+75326400 83bp TCGACAGATACATCGCCATC TTTGTGCCCACAGATCTAGC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 59285 | TCG ACA GAT ACA TCG CCA TC | Common | A | |||
| 59286 | TTT GTG CCC ACA GAT CTA GC | Wild type Reverse | A | |||
| 59287 | Fluorophore-1 | TCC ACT CCG GTG AGC CAG | Quencher-1 | WT Probe | ||
| 59288 | Fluorophore-2 | TCT ACC GGG TAG GGG AGG C | Quencher-2 | MUT Probe | ||
| oIMR5316 | CTA AAG CGC ATG CTC CAG AC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 59285 | 0.40 uM |
| 59286 | 0.40 uM |
| oIMR5316 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.