Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr3:89651915+89652004 90bp TTCCCTTGAAATGCCAACAC TCAGAGGGTCCCAGGAGAGA
Mut= 115 bp
Wt= 90 bp
Fam=Mut
Hex=Wt
Wt Sequence:
ttagagactcaaagtcttataccattcccttgaaatgccaacactaagcctggggcacaccaagtcttgtgttttacctcctaactgtgtgttttctctcctgggaccctctgacgtcctc
Mutant Sequence:
taccattcccttgaaatgccaacactaagcctATAACTTCGTATAGCATACATTATACGAAGTTATATACTCTGTATCCTGTTTTCAGTTCATAGCCCATCTGTAGGGCGCAGTAGTCCAGGGTTTCCTTGATG
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53820 | TGG ACT ACT GCG CCC TAC AG | Mutant Reverse | A | |||
| 53822 | Fluorophore-1 | ATC CTG TTT TCA GTT CAT AGC CCA | Quencher-1 | MUT Probe | ||
| 54406 | TTC CCT TGA AAT GCC AAC AC | Common | A | |||
| 54407 | TCA GAG GGT CCC AGG AGA GA | Wild type Reverse | A | |||
| 54408 | Fluorophore-2 | AAG CCT GGG GCA CAC CA | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53820 | 0.40 uM |
| 54406 | 0.40 uM |
| 54407 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.