C57BL/6J-Kcnn3^em1Lutzy/Mmjax

Stock number: 034602
Product name: Kcnn3^V556F cKI

Research areas: Cell Biology Research, Neurobiology Research, Research Tools

Description

Kcnn3^V556F conditional knock-in/knock-out mice carry a lox-stop-lox (LSL) inserted upstream of the clinical V556F gain of function mutation in the Kcnn3 (potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3) gene. The insertion of the LSL cassette is believed to result in a null allele. These mice may be useful in studying Zimmermann–Laband Syndrome (VLS).

Mice expressing the V556F mutation are available as B6J(CBA)-Kcnn3^em1.1Lutzy/Mmjax (MMRRC Stock No. 071601).

Detailed description

Kcnn3 (potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3) is expressed in the soma and dendrites of dopaminergic neurons in the substantia nigra and influences their action potential frequency. Defects in dopamine (DA) releasing neurons have been sighted in pathologies such as schizophrenia and Parkinson's disease. SK3 is also expressed in smooth muscle of the bladder and uterus, and endothelia of the vasculature where the channels participate in blood pressure regulation.

Kcnn3^V556F conditional knock-in/knockout mice carry a lox-stop-lox (LSL) inserted upstream of the V556F mutation in exon 5. The clinical V555F gain of function mutation is associated with Zimmermann–Laband Syndrome (VLS), a cranial malformation syndrome. The LSL cassette prevents expression of the V556F mutation until the cassette is removed by cre-mediated recombination of the loxP sites.The LSL cassette is believed to result in a null allele. Prior to recombination, homozygous mice are viable and fertile.

Mice expressing the V556F mutation are available as B6J(CBA)-Kcnn3^em1.1Lutzy/Mmjax (MMRRC Stock No. 071601).

Development

This Kcnn3 conditional knockin/knockout allele was generated using CRISPR/cas9 endonuclease-mediated genome editing. The targeting vector is designed to insert a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of a mutant exon 5 containing a valine to phenylalanine (V556F, GTG to TTT) substitution at position 556 in the Kcnn3 (potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3) gene on chromosome 3. The mutation is located in the HA helix. PAM deletion mutations to eliminate recutting with CRISPR/Cas9 were inserted in intron 4 and 5. Kcnn3 transcript Kcnn3-201 (ENSMUST00000000811.7) was used as reference for the exon number and guide sequences. Guides (GAAATGCCAACACTAAGCCT, AAATGCCAACACTAAGCCTG, ATGCACTCAGTAGGGGCATT, and CATGCACTCAGTAGGGGCAT), double-stranded plasmid donor and Cas9 nuclease were introduced into single cell C57BL/6J zygotes and transferred to pseudopregnant females. Progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice for germline transmission. The colony was backcrossed to C57BL/6J for at least two generations.

 

 

Allele

Symbol: Kcnn3^em1Lutzy
Name: endonuclease-mediated mutation 1, Cathy Lutz
MGI accession ID: MGI:7526139
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Null/Knockout; Humanized sequence
Marker symbol: Kcnn3
Marker name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Marker synonyms: hSK3; KCa2.3; SK3; SKCA3; small conductance calcium-activated potassium channel 3; ZLS3
Chromosome: 3
Strain of origin: C57BL/6J
Molecular note: CRISPR/cas9 genome editing used guide RNAS (GAAATGCCAACACTAAGCCT, AAATGCCAACACTAAGCCTG, ATGCACTCAGTAGGGGCATT, and CATGCACTCAGTAGGGGCAT) to insert a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of a mutant exon 5 containing a valine to phenylalanine (V556F, GTG to TTT) substitution at position 556 in the gene. The mutation is located in the HA helix. PAM deletion mutations to eliminate recutting with CRISPR/Cas9 are inserted in intron 4 and 5. Kcnn3 transcript Kcnn3-201 (ENSMUST00000000811.7) was used as reference for the exon number and guide sequences. The orthologous clinical V555F gain of function mutation is associated with Zimmermann–Laband Syndrome (VLS), a cranial malformation syndrome.