For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:80547672-80547808 137bp GGATTGCTCACGTACCCAAC TGCTCAAGGTCAGGTACAACA
Mut = 142 bp
Wt = 137 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GGTGCTGATCCTCCGTAGGGCTCTCATTGGCAGGACCGCgtagggtctggcggcaatgaggctgggtgggaaggcaggggtgtgacccaaggaggcaccagagtgaggagtgcatgtgtgttttcagccacccaaggagaaggctgaggagaagacacatgcgggcctgaccactttgttcccggggcagaagaggagggtctcacacctttgcaagccaggcaaggaggtaagacccagatatggggatacagggcgggcctctggaggaaggagatttgccaccacagttgggcaaaggacccctgctgtcggcctttggtaagctggtatctggggcttcatgtcccatccagatctgggcacaggaacagtgcacggaggggtggataaatccccatgggttttagagttgagtgggcagtccaacctcagagcccaggctatctcagttgtggccggaaggtggtgaggatagtaggggaggcctgtgtggggtgtggtagcaagcaagggctccacaaacatccctggtgcagtctccgaggagacatgagcgcagacagagtactggtgggcagaggaacatggaagaggagcttctgcagcctcctcaccatgcttgtctggagtgctctggacgggggctagctctaggatctgtgctctttcagtcagaggccccaaagaggacccccgtggctcccccagcacgccccccgactgctcaggaggtgtgctaccggcgagcacagctagcacagagggactcggccagttggctacaggccgccccgcggccaacagagaggctctcctccgtgcacatctcagcgcctggggagaagaggaggattgctcacgtacccaacccccgactggctgccggtaagtcctgaccctgccctttcttggaccccttgccttggctcgtgcagtatgagaggaagcagcgcTCGGAGAACTTATGTTGTACCTGACCTTGAGCACCCTCC
This mutation is a 917 bp deletion beginning at Chromosome 10 position 80,547,705 bp and ending after 80,548,621 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 53071 | TGC TCA AGG TCA GGT ACA ACA | Common | A | |||
| 53072 | GGA TTG CTC ACG TAC CCA AC | Wild type Forward | A | |||
| 53073 | GAC ACG CCC ACT TGT CCT | Mutant Forward | A | |||
| 53074 | Fluorophore-1 | CGG TAA GTC CTG ACC CTG CC | Quencher-1 | WT Probe | ||
| 53075 | Fluorophore-2 | CTC ATT GGC AGG ACC GCT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53071 | 0.40 uM |
| 53072 | 0.40 uM |
| 53073 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.