For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:34109607+34109725 119bp AACGGAAGATGGGTACATCC TCTGGGCTGCAAGAAGACT
Mut = 147 bp
Wt = 119 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
TCACCAATACTGCAAAATATAAAAACTAATCACACTTAAATCCAAGGAGAATTAGCTGGTTTGACCTAAGTAGCGTCAGTTAGGGAGAGACCAGGACCTTCTTGCAATGCCAAAGAAGCTACTCCTACCCTtgagttgttgggattgtggccatgtagacctgaagtctaaataaatattgaggcttttgtttgtttttccttagagcgaaatcatcaaacacaagggttatcccagtgaggagtatgaagttgcaacggaagatgggtacatcctttctgtgaacagaatccctcggggacagacacggttaaagaaggaaggtatggtttactcagtgtcactccaacatgacagtcttcttgcagcccagactttcttgatatttggaattaagttttggttcttaggacagactaagatcctttggttaggGGGAATGATAGAGTCAGTCCCCGAGTAATCCCTATCTACATTGCCAGAGTATATTTCATCCATACTCATAGTAAGCAACTATCTCAGAGGTATGTTTCAAAAATACCTTTGATCTGCTGAAGGATCACAGGGGAAGGACATA
This mutation is a 304 bp deletion beginning at Chromosome 19 position 34,109,483 bp and ending after 34,109,786 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49675 | AAT CCA AGG AGA ATT AGC TGG TTT G | Mutant Forward | A | |||
| 51155 | AAC GGA AGA TGG GTA CAT CC | Wild type Forward | A | |||
| 51156 | TCT GGG CTG CAA GAA GAC T | Wild type Reverse | A | |||
| 51157 | Fluorophore-1 | ATC CCT CGG GGA CAG ACA C | Quencher-1 | WT Probe | ||
| 51270 | GGA TGA AAT ATA CTC TGG CAA TG | Mutant Reverse | A | |||
| 51271 | Fluorophore-2 | CCT TCT TGC AAT GCC AAA GAA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49675 | 0.40 uM |
| 51155 | 0.40 uM |
| 51156 | 0.40 uM |
| 51270 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.