C57BL/6NJ-Lipm^em1(IMPC)J/Mmjax

Stock number: 034318

Description

This CRISPR-generated knock-out mutant of the lipase, family member M (Lipm) gene has been generated by the Knockout Mouse Phenotyping Program (KOMP²) at The Jackson Laboratory. Lipm encodes an enzyme required for lipid metabolism of the most differentiated epidermal layers and is also involved in keratinocyte differentiation.

Detailed description

This strain was generated by the Knockout Mouse Phenotyping Program (KOMP³) at The Jackson Laboratory using CRISPR technology. The targeted gene, lipase, family member M (Lipm), encodes an enzyme required for lipid metabolism of the most differentiated epidermal layers and is also involved in keratinocyte differentiation. The alteration resulted in the deletion of 304 bp in exon 3 and 186 bp of flanking intronic sequence, including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 57 amino acids later. As mice are characterized, phenotype data will be accessible on the International Mouse Phenotyping Consortium website.

Development

Guide RNAs (CCACAATCCCAACAACTCAA and CTATCATTCCCCCTAACCAA) were designed to create a deletion of 304 bp in exon 3 of the lipase, family member M (Lipm) gene beginning at Chromosome 19 position 34,109,483 bp and ending after 34,109,786 bp (GRCm38/mm10). The mutation is predicted to delete ENSMUSE00000144872 (exon 3) and 186 bp of flanking intronic sequence, including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 57 amino acids later. Guide RNAs and Cas9 nuclease were introduced into C57BL/6NJ-derived fertilized eggs with well recognized pronuclei. Embryos were transferred to pseudopregnant females. Correctly targeted pups were identified by sequencing and further bred to C57BL/6NJ (Stock No. 005304) to develop the colony.

Allele

Symbol: Lipm^em1(IMPC)J
Name: endonuclease-mediated mutation 1, Jackson
MGI accession ID: MGI:6360918
Generation method: Endonuclease-mediated
Attributes: Null/Knockout
Marker symbol: Lipm
Marker name: lipase, family member M
Chromosome: 19
Strain of origin: C57BL/6NJ
Molecular note: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCACAATCCCAACAACTCAA and CTATCATTCCCCCTAACCAA, which resulted in a 304 bp deletion beginning at Chromosome 19 position 34,109,483 bp and ending after 34,109,786 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000144872 (exon 3) and 186 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 57 amino acids later.