For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 108 bp
Wild Type = 99 bp
>chr10:19904880-19904978 99bp GTCAGCATGTCTTTGGTGGA GGAAGCACAGCCCAGGAA
Sequence
Wt Sequence (with deletion in lowercase):
TCTCACAAGTGCATGCTGTGAGTCACAGGTGCACTACAATAAAAGCAGGTGATGTCAGCATGTCTTTGGTGGATACCTCATATGAGTGTTTGGAAACCTCCTTTCAgtttaactttggagctatctacctgcccttcctgggctgtgcttccaggccactgtggagtacctgctctatttatctcttgtagttttcaagatcatctgaggtaatgtgtgttacaatatgtgaaaaacaaggaaaaaaacagtaactataaaattaagatgttaatcattttgtgatctgcagtgcatgtattttcttttctggcgtagctttgactggaatgacggcttgtttgacgttacctggagtgaaaacaatgagcatgtccttgtcacctgtagtggtgatggctcactgcagctctgggacactgccaaagccacaggccctctccaagtctataaagagcacacgcaggaggtatgatgatggcttcccttattgtttgtttgaaatctctttgggatgaacacagggaaatgctttcaggggacaaggttaagctttaatgtttcttattcatagtagatgtcacttattattctgttattcaaacataaagtacttcttagcctaagacaagacaagaaaaggtcaggcttctcattaggcaacagcagtgcctctagcaggcacgGTGGCATCCTTCCCTCCAGAGGGCCTCAGCCTTCCTTATGCCCTATGAACACGCCTACACGCAGTGCCTCAGGAGAGGGTGGGCGGGCTGTTCGCAGGCTCTCTCACGAT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48755 | GTC AGC ATG TCT TTG GTG GA | Common | A | |||
| 48757 | GGA AGC ACA GCC CAG GAA | Wild type Reverse | A | |||
| 48758 | Fluorophore-1 | ACT TTG GAG CTA TCT ACC TGC C | Quencher-1 | WT Probe | ||
| 48759 | GGC GTG TTC ATA GGG CAT AA | Mutant Reverse | A | |||
| 48760 | Fluorophore-2 | CCT CCT TTC AGT GGC ATC CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 48755 | 0.40 uM |
| 48757 | 0.40 uM |
| 48759 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.