Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 109 bp
Wild Type = 122 bp
>chr11:102432793+102432914 122bp CACACTGGTAGGACGCTGA TCTACTCTGAGGCCACGCACT
Wt Sequence: gccagctgacgcatgtgcgcttgctgcacactggtaggacgctgacacaagcgacacatctgcttgctttcctgttggcttgttgagaagactcaatgaagccagggccttggtcagagcacaggggagtgcgtggcctcagagtagaaggtggcacagagtttaaggtggctgccaaactttgcttggcatttgtagGCAGACCATGTGGGTCCTGA
Mutant Sequence: TGACGCATGTGCGCTTGCTGCACACTGGTAGGACGCTGACgtcgacATAACTTCGTATAGCATACATTATACGAAGTTatattaagggttccggatcaacgaagttcctattccgaagttcctattctctagaaagtata
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40717 | GAG AAT AGG AAC TTC GGA ATA GG | Mutant Reverse | A | |||
| 47089 | CAC ACT GGT AGG ACG CTG A | Common | A | |||
| 47090 | Fluorophore-1 | AAG GGT TCC GGA TCA ACG AAG T | Quencher-1 | MUT Probe | ||
| 47091 | TCT ACT CTG AGG CCA CGC ACT | Wild type Reverse | A | |||
| 47092 | Fluorophore-2 | AGA CTC AAT GAA GCC AGG GCC T | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40717 | 0.40 uM |
| 47089 | 0.40 uM |
| 47091 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.