For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 75 bp
Wild Type = 83 bp
>chr16:35279300+35279382 83bp GAACCCAGAGGATGAAGTGG GGACGTGTTCAGATCGCAGT
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46480 | Fluorophore-1 | CAT CGA TGC CAG GAG CAT | Quencher-1 | WT Probe | ||
| 46482 | GAA CCC AGA GGA TGA AGT GG | Common | A | |||
| 46483 | GGA CGT GTT CAG ATC GCA GT | Wild type Reverse | A | |||
| 46486 | CTA TGC CCT GCC TTG CTT CT | Mutant Reverse | A | |||
| 46487 | Fluorophore-2 | CGA GTT TCT GGC ATC AGG AG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46482 | 0.40 uM |
| 46483 | 0.40 uM |
| 46486 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.