For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:105675042-105675138 97bp GCCTTGCGTTACATTGTCAG GAAGTCAGACAAACAGAAACACAGA
Mutant= 105 bp
Wild Type = 97 bp
Sequence
CCAGTGCTTTTAACCACTGAGCCTTTTTCTCCAGCCCAGCCTTGCGTTACATTGTCAGTGCTCAGCAcctcggtgggcatcttcattcacatcattgaaaaagttgacattctgtgtttctgtttgtctgacttcaaaatgagtctgtttttattctctctagtgtctcaatgaaatcctggagtcagcagatgcaccattagaagtcactgaaggatttattcagtccatttccctgtccgtcccatggggctccttgctgcaggacaactgtgccctggaagtgagaggactggagatggtcttccggcctcgacctcgagtaggtaggtgtttcctggtgcccgttaacccagctGTAAGCAAGTGAGCGTTGGATTGATGACTTTCAACTGGGTCTGTGAGACTTTTCAGTTGCTAGGATACGAGGATTTAGCACTGTAGGATGTATGTGAGTATGCCTATA
A 291 bp deletion beginning at Chromosome 12 position 105,674,819 bp and ending after 105,675,109 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45122 | GCC TTG CGT TAC ATT GTC AG | Common | A | |||
| 45123 | GAA GTC AGA CAA ACA GAA ACA CAG A | Wild type Reverse | A | |||
| 45124 | AAA TCC TCG TAT CCT AGC AAC TG | Mutant Reverse | A | |||
| 45125 | Fluorophore-1 | TCG GTG GGC ATC TTC ATT | Quencher-1 | WT Probe | ||
| 45126 | Fluorophore-2 | AGC AAG TGA GCG TTG GAT TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45122 | 0.40 uM |
| 45123 | 0.40 uM |
| 45124 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.