Protocol 33969: Standard PCR Assay - Gt(ROSA)26Sor<tm1(CAG-dcas9,-BFP)Khk>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~320 bp
Heterozygote = ~320 bp and 241 bp
Wild type = 241 bp

>chr6:113025964-113026204 241bp AAGGGAGCTGCAGTGGAGTA CAGGACAACGCCCACACA

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
24500 CAG GAC AAC GCC CAC ACA Wild type Reverse A Rosa
42561 GAC CGG AAG AGG TAC ACC AG Mutant Forward A Cas9
42562 CTC CAC TGC CAG AAC CTT TC Mutant Reverse A SunTag
oIMR9020 AAG GGA GCT GCA GTG GAG TA Wild type Forward A Rosa

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
24500 0.50 uM
42561 0.50 uM
42562 0.50 uM
oIMR9020 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.