For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:66672417+66672508 92bp CAGAGAAGTACCTGGCAGCA CCCAGTATAATGAGCCCTTTTC
Mut= 83 bp
Wt= 92 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CCTTATTCCCCTCTGCTGTGGAGTTACATGCAGAGTCCTCACCTCTAGCTATGGAATACTCTTCCTGCTTCTGTATCTTACTCAAGCTTCCTATAGGCCCAATCTGCTGGCTAATGCTAGTCAGAACCACTGAGGATTCAAGATTGTGAGGGAGGAGTTAAGAAGTATGTACGCCTCCCttttttgccagcgttgtgtatgtttctctctgaagtttcaggcctgccttgtccccaggaggatcttttgtctccctaaccaccttctaccccaagccaccctgcaactcgcattgctgcctctcctgccttgtgtgatcacaactctgactttcctgtatgacttgctagactttggcctcactgagctggagccaaaatgtggcttcagaaaggctatatggtatcacatgatatttctctcttcaggacagtccaatgccaaaatgatggtcaatcttgctggtgtgtggattctgatggcagagaagtacctggcagcaggcagctggggaggccaacagtttgtacgtaacaaaggaggcacctaatGGAAAAGGGCTCATTATACTGGGGCACCTCACATCTAGGGACAAAAACTAGACTTAAGTAAGTGAGTTGGGCAGTCGCCCTAAGGGCTGCTAGCTTCTCATCATTGAATATGTAGAAGGTCCAGTTTCCTAAAGACCACTATAAAAACCATATGAGACACTTGAGCCTAGCCAGTAGCTAGCAAGTACTTCCCA
This mutation is a 372 bp deletion beginning at Chromosome 15 position 66,672,114 bp and ending after 66,672,485 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39602 | CAG AGA AGT ACC TGG CAG CA | Wild type Forward | A | |||
| 39604 | CCC AGT ATA ATG AGC CCT TTT C | Common | A | |||
| 39605 | GTC AGA ACC ACT GAG GAT TCA AG | Mutant Forward | A | |||
| 39606 | Fluorophore-1 | AGG CCA ACA GTT TGT ACG TAA CA | Quencher-1 | WT Probe | ||
| 39607 | Fluorophore-2 | TAA GAA GTA TGT ACG CCT CCC G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39602 | 0.40 uM |
| 39604 | 0.40 uM |
| 39605 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.