For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 81 bp
Wild Type = 115 bp
>chr16:91492910+91493024 115bp TGTCAACATACTACAACGACCAAG CATTCCACGAAGATGTGCTG
Sequence
Wt Sequence:AAGAAAAGACGAGGCGAAGTGGTTAAAAGTGCCTGAATGTCAACATACTACAACGACCAAGTGtgaattctCTTTACTGGACACAAATGTGTATATCAAAACACAGTTTCGTGTCAGAGCAGAGGAAGGGAACAGCACATCTTCGTGGAATGAGGTTGATCCGTTTATTCCATTCTACACAGGTAAGAAGCCGCCATGGCTGGCTATAT
Mutant Sequence: AAAAGTGCCTGAATGTCAACATACTACAACGACCAAGTGTGAATTCgataagcttgattcgagcagtgtggttttcaagaggaagcaaaaagcctctccacccaggcctggaatgtttccacccaatgtcgagcagtgtggttttgcaagaggaagcaaaaagcctctccacccaggcctggaatgtttccacccaatgtcgagcaaaccccgcccagcgtcttg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38760 | TGT CAA CAT ACT ACA ACG ACC AAG | Common | A | |||
| 38761 | GGC TTT TTG CTT CCT CTT GA | Mutant Reverse | A | |||
| 38762 | CAT TCC ACG AAG ATG TGC TG | Wild type Reverse | A | |||
| 38763 | Fluorophore-1 | AAG CTT GAT TCG AGC AGT GTG GTT | Quencher-1 | MUT Probe | ||
| 38764 | Fluorophore-2 | AAA CAC AGT TTC GTG TCA GAG CAG AG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38760 | 0.40 uM |
| 38761 | 0.40 uM |
| 38762 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.