For in-depth product & services help, ask our
Technical Information Scientists
Mutant = ~500 bp
Heterozygote = ~500 bp and 241 bp
Wild type = 241 bp
>chr6:113025964-113026204 241bp AAGGGAGCTGCAGTGGAGTA CAGGACAACGCCCACACA
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 24500 | CAG GAC AAC GCC CAC ACA | Wild type Reverse | A | |||
| 31499 | CTT GTT CTT CAC GTG CCA GT | Mutant Reverse | A | |||
| oIMR9020 | AAG GGA GCT GCA GTG GAG TA | Common | A |
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 24500 | 0.50 uM |
| 31499 | 0.50 uM |
| oIMR9020 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
| Stock Number | Strain Name |
|---|---|
| 036019 | B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm1(tetO-EGFP,-MIR26A2)Jtm/J |
| 037530 | B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm1(tetO-Plk4,-EYFP)Ahol/J |
| 036020 | B6.Cg-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm1.1(tetO-EGFP,-MIR26A2)Jtm/J |
| 034364 | B6;129-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm3(tetO-H3f3a)Hoch/J |
| 034365 | B6;129-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm4(tetO-H3f3a*K36M)Hoch/J |
| 034366 | B6;129-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm5(tetO-H3f3a*K9M)Hoch/J |
| 035243 | B6;129-Gt(ROSA)26Sortm1(rtTA*M2)Jae Hprt1tm2(tetO-mediumFT*)Sguo/Mmjax |
| 036998 | B6;129S4-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm1(tetO-dcas9/KRAB)Jnxu/J |
| 034380 | B6;129S4-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm1(tetO-GFP/RNAi:rluc)Begg/J |
| 034150 | B6;129S4-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm2(tetO-GFP/RNAi:Rpl5)Begg/J |
| 038749 | B6;129S4-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm5(tetO-Cas9/Dntt*)Fcam/J |
| 034363 | B6;129S4-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm6(tetO-Nanog)Hoch/J |
| 034917 | B6;129S4-Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm7(tetO-Pou5f1,-Klf4,-Sox2,-mCherry)Hoch/J |
| 035244 | STOCK Gt(ROSA)26Sortm1(rtTA*M2)Jae Hprt1tm3(tetO-slowFT*)Sguo/Mmjax |
| 011004 | STOCK Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm3(tetO-Pou5f1,-Sox2,-Klf4,-Myc)Jae/J |
| 011011 | STOCK Gt(ROSA)26Sortm1(rtTA*M2)Jae Col1a1tm4(tetO-Pou5f1,-Sox2,-Klf4,-Myc)Jae/J |
| 16 strains use this protocol | |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.