Protocol 31769: Standard PCR Assay - Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas-Chr3
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 129 bp
Heterozygote = 129 bp and 216 bp
Wild type = 216 bp
>chr3:62782450+62782665 216bp ACCCCCATGTCAGAGTTCCT TATACAACCTTGGGGGATGG
 This assay is capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 3.
 
This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR. 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
27367 CGG GCC TCT TCG CTA TTA C Mutant Reverse A vector
37598 ACC CCC ATG TCA GAG TTC CT Common A mChr3
37599 TAT ACA ACC TTG GGG GAT GG Wild type Reverse A mChr3

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
27367 0.50 uM
37598 0.50 uM
37599 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
033265 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD100/RwwJ)F1/J
033245 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD2/TyJ)F1/J
032882 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD32/TyJ)F1/J
033248 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD42/TyJ)F1/J
033254 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD61/RwwJ)F1/J
033255 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD62/RwwJ)F1/J
033256 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD65/RwwJ)F1/J
033257 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD68/RwwJ)F1/J
033258 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD69/RwwJ)F1/J
033259 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD70/RwwJ)F1/J
033260 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD75/RwwJ)F1/J
033261 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD77/RwwJ)F1/J
033262 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD81/RwwJ)F1/J
033263 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x BXD87/RwwJ)F1/J
032883 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x C57BL/6J)F1/J
032881 (B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax x DBA/2J)F1/J
025788 B6.Cg-Mapttm1(EGFP)Klt Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax ACB009 mES cells
025786 B6.Cg-Mapttm1(EGFP)Klt Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax ACB010 mES cells
025787 B6.Cg-Mapttm1(EGFP)Klt Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax ACB011 mES cells
025789 B6.Cg-Mapttm1(EGFP)Klt Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax ACB014 mES cells
008730 B6.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax
006554 B6SJL-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax
041591 NOD.Cg-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas Prkdcscid Il2rgtm1Wjl/SentJ
23 strains use this protocol