For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 144 bp
Wild Type = 150 bp
>chr4:126240200-126240349 150bp CTCATACACCCAGGAAGTGAC CCCCAATCCTAAGCAATTC
Sequence
Wt Sequence (deleted region in lower case):
ATGAAAGCACCAAGATCAGGACCCTCAGTACTAGGGAGACCCTGCCCAGGAATCCCAGGCAAAGAAGAGTCCCACCCATCCTCAGAGAAGCAACTCATACACCCAGGAAGTGACTCAAGTCCatggggaaaaaaaaagctctccaagaactcggatagggatctatcacacataggcttgactcacagccaagtcaggaactttggttgcctgtagtgagtcaggaattgcttaggattggggaggactttctccaggtatggtggctgatcctgagcccagatctttttcccattggcccccaggagcgctatgaagcagcaatccagcggtcagtgaagaagacgtgggctgagatccggcaacagcgctggtcctgggcaggggccctgcaccacagctcccctggacgtaagaccagtgagtgggctggaagtgctggcagacGGGCGGGTGGGTAGGTGGGCAGGGCTGTGGACAGGAACACTATACACAAggcGGTCGGTCGTTCACTACTCCCTGCACCAGGTGTGTCTTGCTTCGTGTGACTTGTGTCTTCTGGAAT
325 bp deletion beginning at Chromosome 4 negative strand position 126,240,320 bp and ending after 126,239,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000364976 (exon 5) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GGC) 59 bp after the 325 bp deletion that will not alter the results of the exon deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37127 | CTC ATA CAC CCA GGA AGT GAC | Common | A | |||
| 37128 | CCA GAA GAC ACA AGT CAC ACG | Mutant Reverse | A | |||
| 37129 | CCC CAA TCC TAA GCA ATT C | Wild type Reverse | A | |||
| 37130 | Fluorophore-1 | CAG GGC TGT GGA CAG GAA | Quencher-1 | MUT Probe | ||
| 37131 | Fluorophore-2 | TCG GAT AGG GAT CTA TCA CAC ATA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37127 | 0.40 uM |
| 37128 | 0.40 uM |
| 37129 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.