Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr1:110048639+110048829 191bp TTTCTCAGAGCTGGATTTCACA CATCAGAGTGGAGCTGGTGA
Mutant= 177 bp
Wild Type = 191 bp
Wt Sequence: tttctcagagctggatttcacatTGtatattctggcttcttagcacaatcagcacttagctcatctttccaaaaacaatgaaatttcttacagctgtgacatgaaagtgatttttacataactttatattgctgactctcttgtaagttaatctcatctcacatgaatttttcaccagCTCCACTCTGATG
Mutant Sequence: tttctcagagctggatttcacatTgtgcaggcgtggtcagaaaggTtttccttttaacaatactcacttctttaaaattatgattacaataatctctaacaagttactattttgtttttaaaaacgtacttccctgtaaattcttccagctgtccctccatcccctctctcccta
355 bp of flanking intronic sequence including the splice acceptor and donor. Additionally, 55 bp after the end of this exon there is 21 bp of retained endogenous sequence (GTGCAGGCGTGGTCAGAAAGG) followed by an additional 144 bp deletion
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33475 | CAT CAG AGT GGA GCT GGT GA | Wild type Reverse | A | |||
| 35748 | TTT CTC AGA GCT GGA TTT CAC A | Common | A | |||
| 35749 | ACT AGG GAG AGA GGG GAT GG | Mutant Reverse | A | |||
| 35750 | Fluorophore-1 | AGC ACA ATC AGC ACT TAG CTC AT | Quencher-1 | WT Probe | ||
| 35752 | Fluorophore-2 | ACG TAC TTC CCT GTA AAT TCT TCC A | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33475 | 0.40 uM |
| 35748 | 0.40 uM |
| 35749 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.